ID: 1089539941

View in Genome Browser
Species Human (GRCh38)
Location 11:119183726-119183748
Sequence AGGTTGGTAGTGGTGCTTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089539941_1089539955 23 Left 1089539941 11:119183726-119183748 CCCTGAAGCACCACTACCAACCT 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1089539955 11:119183772-119183794 CCTCTGACTGTGTCACCAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1089539941_1089539952 21 Left 1089539941 11:119183726-119183748 CCCTGAAGCACCACTACCAACCT 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1089539952 11:119183770-119183792 AGCCTCTGACTGTGTCACCAAGG 0: 1
1: 0
2: 2
3: 134
4: 3277
1089539941_1089539953 22 Left 1089539941 11:119183726-119183748 CCCTGAAGCACCACTACCAACCT 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1089539953 11:119183771-119183793 GCCTCTGACTGTGTCACCAAGGG 0: 1
1: 0
2: 2
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089539941 Original CRISPR AGGTTGGTAGTGGTGCTTCA GGG (reversed) Exonic
902709250 1:18227371-18227393 AGGATGGTGGTGGGGCTTAAGGG + Intronic
903228081 1:21905018-21905040 TGGTTGTTAGTGGTGTCTCATGG - Intronic
903531846 1:24037041-24037063 AGGCTGGGCGTGGTGGTTCATGG + Intergenic
907363992 1:53945347-53945369 GGGCTGGTAGTGGCGCTTCCAGG + Intronic
907740442 1:57160571-57160593 ATTTTGGTTGTGGTGCTGCACGG + Intronic
909405397 1:75282605-75282627 GTGTTGGGAGTGGAGCTTCATGG + Intronic
909554020 1:76932690-76932712 AGCTTGGAAGTGGGGCTGCAGGG - Intronic
910643046 1:89484942-89484964 AGGTGGATAGTTGTGGTTCAAGG - Intergenic
911237449 1:95426360-95426382 AGACTGGTAGTGGCACTTCAGGG - Intergenic
917552832 1:176053387-176053409 GGGTTGGTAGAGGAGCATCAAGG - Intronic
919982997 1:202653986-202654008 AGGTGGCCAGTGGGGCTTCAAGG + Intronic
920392224 1:205614850-205614872 AGGGTGGTAGTGGTGGTGAATGG + Exonic
924640777 1:245831496-245831518 AAGTTGTTAGTGGTTCTTCTGGG - Intronic
1063019752 10:2115995-2116017 AGGTTGTTATTTCTGCTTCATGG - Intergenic
1064968643 10:21040636-21040658 AGGTTGGTAGTGGGGTTTGGTGG - Intronic
1068466734 10:57402980-57403002 ATGTTGGAAGTGGGGCTTAATGG + Intergenic
1069819497 10:71218581-71218603 AGGTGGGTCCTGGTGCTCCAGGG + Intronic
1071569931 10:86691273-86691295 AAGTTGGGAGTGGGGCTGCATGG - Intronic
1072882095 10:99237471-99237493 AGGTTGGTAGAGGCTTTTCAGGG - Intergenic
1073151072 10:101311764-101311786 AGGTTGGTAGTGGTTCTGGCGGG + Intergenic
1077203906 11:1331857-1331879 AGGTTGAGAGTGGTGGCTCATGG + Intergenic
1077757624 11:5051269-5051291 AGGTTGGTAGTGATAGCTCATGG - Intergenic
1077890291 11:6413419-6413441 AGGGGGGTAGTGGTGAGTCAGGG - Intronic
1078382245 11:10853905-10853927 ATGTTTGTAGTGATGCTTCTAGG - Exonic
1079857037 11:25617996-25618018 AGGTTGGTGTTGGTATTTCATGG - Intergenic
1081439875 11:43068295-43068317 AAGGTGGTAGTGGAGGTTCAAGG - Intergenic
1084433563 11:69124685-69124707 AGGTTGGTCTTTGTGCCTCAGGG + Intergenic
1084849730 11:71929084-71929106 AGGTTGGAGGTGGTGCTGCTGGG + Exonic
1085994695 11:81896691-81896713 ATTTTTGTAGTGGTGCTGCATGG - Intergenic
1087168763 11:95029083-95029105 AGGCTGGGTGTGGTGCCTCACGG - Intergenic
1087415688 11:97852583-97852605 AGGTTGGGTGTGGTGGCTCATGG - Intergenic
1089539941 11:119183726-119183748 AGGTTGGTAGTGGTGCTTCAGGG - Exonic
1089584801 11:119503434-119503456 ATGTTGGAAGTGGAGCCTCATGG + Intergenic
1089870888 11:121671839-121671861 AGGTGGGTAGTGGTGCTCGATGG - Intergenic
1091116494 11:133018466-133018488 AGGCTGGTAGTAGTGTTTCTGGG - Intronic
1092077595 12:5686246-5686268 ATGTGGGTAGTGGTCCTGCAGGG - Intronic
1093751486 12:22805043-22805065 ATGTTTGTAGTGGAGCTTCGAGG - Intergenic
1094415729 12:30212924-30212946 GGTCTGGTGGTGGTGCTTCAGGG + Intergenic
1095840037 12:46682966-46682988 AGGTTGGGAGAGGTGATTCCTGG - Intergenic
1099928256 12:89043788-89043810 AGGGTGGTGGGGGTGCTTCTAGG + Intergenic
1104893749 12:132152085-132152107 AGGGTGGTAGTGGCGCTGGAGGG - Exonic
1107577795 13:41746032-41746054 AGATTGGAAGTGGTGGTTAAAGG + Intronic
1112492998 13:99883916-99883938 ATGATGTTTGTGGTGCTTCAGGG - Intronic
1112996478 13:105580499-105580521 AGGCTAGTAGTGATGATTCAGGG - Intergenic
1113433344 13:110268980-110269002 AGGTGGGCCGTGGTGCTGCAAGG - Intronic
1115616473 14:35100016-35100038 AGGCTGGGTGTGGTGCCTCACGG - Intronic
1115728111 14:36239200-36239222 AAGATGGTGGTGGTGCTTCAAGG - Intergenic
1117694626 14:58347018-58347040 AGATTGATAGTGGTGCTGTATGG + Exonic
1122083677 14:99284802-99284824 AGGTTGGTTGTGAAGCTTCCAGG - Intergenic
1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG + Intronic
1139055234 16:63175154-63175176 AGGTTGGTCATGGTGATCCAAGG - Intergenic
1140424452 16:74849119-74849141 AGGTTGGCAGTGATGCTCAAAGG - Intergenic
1150382147 17:64729293-64729315 AGGTTGGGGGTGGTGATTCGTGG + Intergenic
1150452899 17:65283988-65284010 AGGTTGGAAGTAGTGATTCCTGG - Intergenic
1150774121 17:68065558-68065580 AGGTTGGGGGTGGTGATTCGTGG - Intergenic
1153014403 18:570610-570632 AGGGTTGTAGTGGTGATTAAAGG - Intergenic
1154225642 18:12501285-12501307 AGAATGGGAGTGATGCTTCATGG + Intronic
1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG + Intergenic
1161750211 19:6090486-6090508 AGGTGTGAAGTGGTGTTTCATGG - Intronic
1162210042 19:9083946-9083968 AGGTTGGACGTGGTGGCTCACGG + Intergenic
1162275060 19:9647056-9647078 AGGTTGGGCACGGTGCTTCACGG - Intronic
1163550663 19:17964868-17964890 AGGTGGGTACAGGGGCTTCAGGG + Intronic
1166368234 19:42287839-42287861 AGATTGGAAGTGGTGCAACAAGG + Exonic
1167508897 19:49885534-49885556 AGGCTGGGTGTGGTGGTTCATGG + Intronic
928671606 2:33608908-33608930 GGGGTGGTAGGGGTGCTTCCAGG - Intergenic
931902001 2:66800020-66800042 AGGTTGGATGTGGTGGTTTATGG - Intergenic
932565352 2:72903109-72903131 ATGTTGGACGTGGGGCTTCATGG + Intergenic
936855693 2:116954699-116954721 AAGTTGGTAGTGTTGTCTCATGG - Intergenic
938198065 2:129349249-129349271 AGGTGTGTAGTGGTGTCTCATGG + Intergenic
941312978 2:163957559-163957581 AGGTTGGGAGCGGTGGCTCACGG + Intergenic
942547222 2:177077911-177077933 AAATTGGAAGTGGTGCTTAAGGG - Intergenic
943884119 2:193190360-193190382 AGGCTGGGTGTGGTGGTTCATGG - Intergenic
946681473 2:222221569-222221591 AGGTCAGTAGAGGGGCTTCAGGG + Intronic
947359329 2:229331856-229331878 AGGATGATAGAAGTGCTTCAGGG - Intergenic
1169784220 20:9341583-9341605 AGGTTGGTCTTGGTGTCTCAGGG + Intronic
1169972785 20:11287818-11287840 ATGTTGCTACTGGTGATTCAAGG - Intergenic
1170080770 20:12472027-12472049 AGCCAGGTAGTGCTGCTTCAAGG + Intergenic
1171224830 20:23433666-23433688 AGGCTGGGAGTGGTGGCTCAAGG - Intergenic
1177161986 21:17557854-17557876 AGGGTTGGAGTGGTGCTTAATGG + Intronic
1178246295 21:30956228-30956250 ATGTTGGAAGTGGTGCTTGGTGG + Intergenic
1179313799 21:40223031-40223053 AGGTTGGTAGGGATGCTGGAGGG - Intronic
1180991185 22:19937615-19937637 AGTTTGGTTGCCGTGCTTCATGG - Intronic
1181593919 22:23902071-23902093 AGGTTAGTAGTGGTGTGTCATGG - Intergenic
1182545328 22:31072205-31072227 AGGTTGGGAGTGATCATTCACGG - Intronic
1184460637 22:44635888-44635910 AGGTTGGGTGTGGTGGCTCATGG + Intergenic
1184729629 22:46365490-46365512 AGGCTGCTAGTGCTTCTTCAGGG + Intronic
949219061 3:1607606-1607628 AGGTTGGTACTGGTGCTGCTGGG + Intergenic
952543731 3:34396123-34396145 AGGATGTTAGTGGGGCTCCAGGG + Intergenic
954535237 3:51354970-51354992 AGGATGGTTGGGGTGCTGCATGG - Exonic
956961716 3:74410521-74410543 GGGATGTTAGTGGTGCTTAAAGG + Intronic
962433791 3:135346274-135346296 ATGTTGGGAGTGGGGCTTAATGG + Intergenic
962486992 3:135853398-135853420 AGGTAGGTCCTGGTGCTACAGGG + Intergenic
964523562 3:157592894-157592916 AGTTTGGTGGTGGTGCTGGAAGG + Intronic
965918120 3:173876139-173876161 AAGTTGGTAGGGGTTCTTAAAGG + Intronic
968780685 4:2578903-2578925 AGGTTGGTCTTGCTGTTTCAGGG + Intronic
971856911 4:32055484-32055506 AGGTTGGAGGTGGGGCCTCATGG - Intergenic
972791996 4:42381612-42381634 AGGTTGGTAATGCTGGGTCAAGG - Intergenic
975276083 4:72503299-72503321 AGGCTGGGAGTGGTGTCTCACGG - Intronic
978561165 4:110034980-110035002 AGGTTGGTGGTGGTGGTTCCTGG + Intergenic
979413340 4:120406125-120406147 GGGTTGGCATTGGTGATTCAGGG - Intergenic
983248817 4:165321266-165321288 AGGTTGGTCTTGTTGTTTCAGGG - Intronic
983499680 4:168484473-168484495 AGTTTGGCAGAGGAGCTTCAGGG - Intronic
984188860 4:176580638-176580660 AGGCTGGGAGTGATGCTGCAGGG - Intergenic
984688179 4:182695188-182695210 TGGTTGGTAGTGGTGATGAAAGG + Intronic
992175088 5:74142213-74142235 AGGATGGTAGTGGTTTTTCCAGG - Intergenic
994355727 5:98792234-98792256 AAGTTTGTAGTGGTGAGTCATGG + Intronic
995451151 5:112302537-112302559 AGGGTGGTAGTGATGATTGAAGG - Intronic
996912833 5:128675077-128675099 AGGTCGTTAGTGGGGCTCCATGG + Intronic
998270229 5:140699919-140699941 AGGGTGGTAGCATTGCTTCAAGG + Intronic
999315877 5:150583705-150583727 AGGTGGTTAGTGGTACTGCAAGG + Intergenic
999458064 5:151734448-151734470 AGGTCGGGAGTGGTGGCTCACGG + Intergenic
1003466114 6:6381648-6381670 TGGTTGCTGGTGTTGCTTCAAGG + Intergenic
1004680296 6:17887340-17887362 AGGTTGTTACTGTTGCATCACGG + Intronic
1007728751 6:43933011-43933033 GGGTGGGCAGTGGTGGTTCATGG + Intergenic
1008419964 6:51286870-51286892 AGGTTGGCAGTATTGATTCAAGG + Intergenic
1013579389 6:111518162-111518184 AGGGTGGGAGTGATGCTGCAGGG - Intergenic
1014046421 6:116893134-116893156 CAGTAGGTAGTGGTGCTTTATGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1020079688 7:5280892-5280914 AGGTTGGGGGTGCTGCTGCAGGG - Intronic
1020656223 7:10930850-10930872 ATGTTGGAGGTGGTGCTTAATGG + Intergenic
1022616568 7:31936996-31937018 AGGTTGGGAGGGGTGCTTCCAGG + Intronic
1022647038 7:32241290-32241312 AGGTTGGCTGTGCTGCGTCAAGG - Intronic
1027696153 7:81413216-81413238 AGTTTAGTAGTGCTGTTTCATGG + Intergenic
1030826411 7:114164677-114164699 AGGTTTGTAGTATTTCTTCAAGG - Intronic
1030859443 7:114606320-114606342 AGGTAGGTACATGTGCTTCAAGG + Intronic
1031522264 7:122780492-122780514 AGGGTGGTGGTGGTGGTTCCTGG - Intronic
1032390813 7:131554508-131554530 AGGCCAGAAGTGGTGCTTCATGG + Intronic
1033845222 7:145423906-145423928 AGATTGGAGGTGGGGCTTCATGG + Intergenic
1034841269 7:154399835-154399857 TGGAGGGTAGGGGTGCTTCATGG + Intronic
1046175991 8:110575535-110575557 ATTTTGAAAGTGGTGCTTCATGG - Intergenic
1046281641 8:112041009-112041031 AGGTTGGTCTTGCTGTTTCAAGG + Intergenic
1046311396 8:112441836-112441858 AGGTTGGTAGAGGGACATCATGG - Intronic
1049401969 8:142432123-142432145 GTGGTGGTGGTGGTGCTTCAGGG - Intergenic
1051630252 9:19134357-19134379 AGGATGGTAGTTGTTCTGCAGGG + Intronic
1052046512 9:23800159-23800181 AGGTTGATTGTGATGCTTTATGG - Intronic
1055619351 9:78107602-78107624 ATGGTGATAGTTGTGCTTCAGGG - Intergenic
1058089076 9:100783478-100783500 AGGTTGGTCTTACTGCTTCAGGG - Intergenic
1058746664 9:107998280-107998302 AGTTTGGTAGTGAGGCTGCATGG + Intergenic
1187050567 X:15691704-15691726 ATGTTGGAGGTGGGGCTTCATGG - Intronic
1189113292 X:38316561-38316583 TGGTAGGTAGTGTTGCCTCAAGG + Intronic
1193319810 X:80107995-80108017 AGGTTGGTATTGCTGTCTCAGGG + Intergenic
1195174993 X:102306146-102306168 GGGTTGGTAGTGGGGCGGCAGGG + Intergenic
1195183872 X:102380947-102380969 GGGTTGGTAGTGGGGCGGCAGGG - Intronic
1195897761 X:109764884-109764906 AGGCTGGGAGTGGTGGCTCATGG + Intergenic
1198521211 X:137454705-137454727 AGGGTGGTCGTGATTCTTCATGG - Intergenic
1199653051 X:149966987-149967009 AGGTTTGTACTGGTAGTTCATGG + Intergenic
1199896322 X:152130899-152130921 AAGGTGGTAGTGGGGCTGCATGG - Intergenic