ID: 1089544275

View in Genome Browser
Species Human (GRCh38)
Location 11:119210908-119210930
Sequence TGTACACGGTTCAGTACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089544275 Original CRISPR TGTACACGGTTCAGTACTAT TGG (reversed) Intronic
920629951 1:207642411-207642433 TGGACCCGGTTTAGAACTATGGG - Intergenic
1070889535 10:79932113-79932135 TTTTCACGTATCAGTACTATTGG + Intergenic
1071209982 10:83329954-83329976 TGTAGAGGGCTTAGTACTATAGG - Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG + Intergenic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1111467527 13:88634976-88634998 TGTTCATGGTTAATTACTATAGG - Intergenic
1127745900 15:61971831-61971853 TGTACACACCTAAGTACTATTGG - Intronic
1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1141362001 16:83404198-83404220 TGTTCACGTTTCAGAACTTTTGG + Intronic
1142363048 16:89636257-89636279 TGTACACGGACCAGAACTGTGGG - Exonic
1151248739 17:72817151-72817173 TGTACAGGCTTCAGAACCATTGG - Intronic
1155200664 18:23514914-23514936 TGTACAGTGTTCTGTAATATCGG + Intronic
943913787 2:193602267-193602289 TATATAGAGTTCAGTACTATTGG - Intergenic
944682973 2:202093794-202093816 TGTAAACTGTTTAGTATTATGGG + Intronic
952127420 3:30317419-30317441 TTTACAAAGTTCAGTACTAAAGG + Intergenic
954152209 3:48663181-48663203 GGGACACGGTTCAGAACTAGTGG - Intergenic
965410431 3:168323391-168323413 TATATAGGGTTCAGTACTATCGG - Intergenic
976893946 4:90084699-90084721 TGTACCCTGTTCAGTGCTAATGG - Intergenic
978086799 4:104664934-104664956 TGTAGACAGTTATGTACTATGGG + Intergenic
978556324 4:109984610-109984632 TGAACACAGATCAGTATTATTGG - Intronic
980039855 4:127926714-127926736 TGTATCAGGTTCAGTGCTATGGG - Intronic
982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG + Intergenic
991132673 5:63142372-63142394 TATAGAGGGTTCAGTACTATTGG - Intergenic
995896757 5:117022152-117022174 TGTCCACTGTTCAGGACAATAGG - Intergenic
999942156 5:156554664-156554686 TCTAAATGATTCAGTACTATGGG + Intronic
1000646804 5:163769444-163769466 TGTACAGGGTGCAGAGCTATGGG - Intergenic
1000955047 5:167533348-167533370 TGTACAGGCTTGAGTACAATGGG + Intronic
1012711822 6:102616753-102616775 TGTACAGGTTCCAGTACAATTGG - Intergenic
1014549635 6:122775322-122775344 TGTACTCTATTCAGTTCTATTGG - Intergenic
1015096495 6:129419903-129419925 TGTACATTTTTAAGTACTATAGG - Intronic
1015657355 6:135533824-135533846 TGTAAATAGTACAGTACTATTGG + Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1027630250 7:80595216-80595238 TGTACACTGCCCAGTACTAAAGG + Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1038969423 8:32615921-32615943 TTTACACGTTTCTGTAATATAGG + Intronic
1039026836 8:33267756-33267778 TATACAGGGTTCTGTACCATTGG - Intergenic
1042259762 8:66846271-66846293 TGTACAGGTTTCTGTACTCTGGG - Intronic
1042666574 8:71213333-71213355 TCTACCCGCTTCTGTACTATGGG + Intronic
1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG + Intronic
1044727042 8:95202434-95202456 TATATAGGGTTCAGTACTCTTGG - Intergenic
1053429104 9:38030242-38030264 TGTACATGGTCCAGGACTAATGG - Intronic
1055485092 9:76748853-76748875 TGCCCACGGTTCAGTACAGTGGG + Intronic
1058500965 9:105615739-105615761 TATATAGGGTTCAGTACTATCGG - Intronic