ID: 1089547620

View in Genome Browser
Species Human (GRCh38)
Location 11:119241842-119241864
Sequence GTGTAGAGATGGAAAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 499}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089547613_1089547620 16 Left 1089547613 11:119241803-119241825 CCATGAGAGAGACAATGATGGCT 0: 1
1: 0
2: 5
3: 34
4: 271
Right 1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG 0: 1
1: 0
2: 3
3: 52
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089547620 Original CRISPR GTGTAGAGATGGAAAGAAGT GGG Intronic
900035354 1:403180-403202 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
900056974 1:638929-638951 GTGGAGGGACAGAAAGAAGTAGG + Intergenic
901147628 1:7077289-7077311 TTGCACAGATGGAAAGAAGCAGG + Intronic
902736339 1:18403775-18403797 GTGTGGAGATGGACAGACATAGG - Intergenic
903517742 1:23923647-23923669 GTGTAGAGGTGAAAATATGTGGG - Intergenic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905689844 1:39934944-39934966 GAGTGGAGATGGAAAGAATGAGG + Intergenic
905702228 1:40026177-40026199 GAGGAGAGAAGGAAAGAAGGAGG + Intergenic
907173135 1:52490727-52490749 GTGCAGAGATCGAAAAAGGTTGG - Exonic
907252853 1:53154313-53154335 GAGTAGAAATGGAAAGAAAATGG + Intergenic
907924800 1:58945066-58945088 TGGCAGAGATGGTAAGAAGTGGG + Intergenic
908065232 1:60396171-60396193 TTGAAGAGATGGCTAGAAGTGGG + Intergenic
908345596 1:63229122-63229144 GGGGAGGGATGGAAAGAAGAGGG - Intergenic
909617267 1:77625058-77625080 GAGTATAGAAGGAAAAAAGTTGG + Intronic
910653772 1:89599431-89599453 GTGGAGAGCTGGACAGAAGTGGG - Intergenic
911124713 1:94330380-94330402 ATGCAGGGAAGGAAAGAAGTGGG - Intergenic
911490145 1:98554980-98555002 TTGGAAAGTTGGAAAGAAGTTGG - Intergenic
911715578 1:101128824-101128846 GTTTAAAGAGGGAAAGAAGCAGG + Intergenic
912393404 1:109320638-109320660 ATGTAGAGCTGAAAGGAAGTGGG - Intronic
912600030 1:110921012-110921034 ATGAAGAGAGGGAAAAAAGTGGG + Intergenic
912912987 1:113781541-113781563 ATGTAGATATGGAATGTAGTAGG - Intronic
913464653 1:119127773-119127795 GGAAAGAGATGGAAAGAAATGGG - Intronic
914895587 1:151668995-151669017 GGGGGGAGATGGAAATAAGTAGG - Intronic
915802238 1:158806786-158806808 GAGCAGAGATGGAAAGGTGTTGG - Intergenic
915925701 1:160017599-160017621 TACTAGAGATGGTAAGAAGTGGG - Intergenic
916389829 1:164319727-164319749 GTGGAGGGATGGGAAGGAGTAGG + Intergenic
916492630 1:165315349-165315371 GGGTAGAGATGAAAGGAAGTAGG - Intronic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917160810 1:172055143-172055165 GTTTAGAGATGAAAAGCAGGGGG - Intronic
917606800 1:176639564-176639586 GTAGAAAGATGGGAAGAAGTAGG - Intronic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
918089011 1:181271643-181271665 GTGTGGAGATTCAAAGAAGGTGG + Intergenic
918208978 1:182334114-182334136 CTGTAGTGATGGAAACAAGAAGG - Intergenic
919168850 1:193928692-193928714 GAGCAGAAATGAAAAGAAGTGGG + Intergenic
919363442 1:196624978-196625000 TTGTTGGGATAGAAAGAAGTTGG + Intergenic
919496035 1:198269203-198269225 GTGAATAGATGTATAGAAGTTGG + Intronic
920275337 1:204800263-204800285 GTGAAGAGGTGGAAAGGAGAGGG + Intergenic
921643331 1:217582152-217582174 GTGTATAGACGAAAAGAAGTAGG - Intronic
922257888 1:223908739-223908761 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
922439853 1:225645882-225645904 GTGTAGAGATTGAATGGTGTAGG - Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
922990634 1:229907999-229908021 ATATAGAGATAAAAAGAAGTAGG - Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
923879659 1:238089691-238089713 ATAGAGAGAAGGAAAGAAGTTGG - Intergenic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
924339085 1:243011514-243011536 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064969615 10:21051375-21051397 GAGTAGAGATGTAAAGCAGTAGG + Intronic
1065067498 10:21985547-21985569 ATATAGAGATGGAAAGCAGGTGG - Intronic
1065712391 10:28531395-28531417 ATGGAGAGATGGAATGATGTAGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068627620 10:59266286-59266308 ATGTAGAGATGTAGAGAATTTGG + Intronic
1068795828 10:61078970-61078992 ATGTGGAGATGGAAATGAGTTGG + Intergenic
1069461181 10:68596290-68596312 CTGTATAGATGGTTAGAAGTGGG + Intronic
1069510030 10:69035264-69035286 GGGAAGAGATGGAAAGACTTGGG + Intergenic
1070758576 10:79008982-79009004 GTGCAGAGAGGGAGAGAGGTGGG + Intergenic
1071045168 10:81364845-81364867 GTGAAGAAATGGAAAAATGTAGG - Intergenic
1071845198 10:89514780-89514802 TTGTAGAGATGAAAAGGAGCGGG + Intronic
1072265213 10:93720644-93720666 TTTTAGAGATGGAAAAAACTAGG - Intergenic
1072457489 10:95589521-95589543 GTGAAAAGATGGCAAGAACTGGG - Intergenic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1073107938 10:101043202-101043224 GTGGAGAGAGGGAAAGGAGGAGG - Intergenic
1073259475 10:102178094-102178116 GTAGAGAGATGGAAAAAAGAGGG + Intergenic
1073618184 10:105019475-105019497 GAGAAGAGATGGAAAGAGGAAGG - Intronic
1073712656 10:106062330-106062352 GGGGAGAGATGGGTAGAAGTTGG - Intergenic
1075513890 10:123094288-123094310 GTGTAGAGAGGGCAAGAACTTGG - Intergenic
1075559528 10:123458475-123458497 AGGTAGAGAGGGAAAGAAGAAGG - Intergenic
1075813074 10:125241420-125241442 GTTGAGAGATGGTAAGAAGGAGG + Intergenic
1077279648 11:1736850-1736872 GAGTGGAGCTGGAAAAAAGTTGG + Intronic
1077891316 11:6419864-6419886 GTGTAAAGATGTAAGGAAGATGG + Intergenic
1078050896 11:7963836-7963858 GTGTTGAGAGGGAAAGAGGAAGG - Intronic
1078173607 11:8951138-8951160 ATGTAGAGATGAAAACATGTAGG - Intronic
1078713374 11:13816498-13816520 GTGTAGAGTTGGTAAGGTGTTGG + Intergenic
1078919679 11:15817868-15817890 AGGTAGAGATGGGAAGAAGATGG - Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1079921971 11:26443859-26443881 TTGGAGAGAGGGAAAGGAGTAGG - Intronic
1080110293 11:28559222-28559244 GAGAAAAGATGGAAAGACGTAGG - Intergenic
1080438094 11:32264805-32264827 GTGAAGAGAGGGAAAGATGAAGG + Intergenic
1080614277 11:33932647-33932669 GGTCAGAGATGGTAAGAAGTGGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081721843 11:45295092-45295114 GTGCTGTGATGGAAAGAAGGTGG + Intergenic
1082057651 11:47832971-47832993 GTGTAGAGCTGGGAAGAAATGGG + Intronic
1083996145 11:66273682-66273704 GTGTAGACATGGACAGAGGAGGG - Intronic
1084470423 11:69356206-69356228 GAGTAGGGAGGGAAAGAAGGAGG + Intronic
1084697481 11:70764320-70764342 ATGTATAGATGGATAGAAGGAGG - Intronic
1084898713 11:72294163-72294185 GGCAAGAGATGGAAAGCAGTGGG - Intronic
1085130748 11:74036209-74036231 GAGTAGAGGTGGAAACAAATAGG - Intronic
1085718951 11:78896601-78896623 TTGGAGAGATGGCAAGTAGTTGG - Intronic
1085908095 11:80788809-80788831 GTGAGGATATGGAAAGAAGGTGG - Intergenic
1086325356 11:85693149-85693171 GTGGATAGATGCAAAGAAGGTGG + Intergenic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087137823 11:94738588-94738610 GGGTGTAGATGGAAAGAAGGTGG + Intronic
1087436227 11:98121480-98121502 GTGAAGATATGTAAAGATGTGGG - Intergenic
1088400466 11:109418087-109418109 TCTTAGAGATGGAAAGATGTGGG - Intergenic
1088701607 11:112418062-112418084 GTGCAGAGAGTGAAAAAAGTGGG + Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1090045070 11:123324265-123324287 GTGTAGAGAAGAGAAGTAGTGGG - Intergenic
1090067467 11:123515601-123515623 GTGGAGAGATTGAAAAAAATTGG + Intergenic
1091338318 11:134790736-134790758 GGGGAGAGATGAAAAGAGGTTGG - Intergenic
1091871358 12:3893824-3893846 GTGTAGAGAAGGAGAGAAACGGG - Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1094092402 12:26665229-26665251 GGGAAGAGAAGGAAAGAAGTAGG + Intronic
1094128710 12:27051764-27051786 GGGAAGAGATGGTGAGAAGTGGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094699632 12:32856412-32856434 GAGTAGGGAGGGAAAGATGTGGG + Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096069233 12:48765697-48765719 GTGCAGAGGGGGAAAGAAGGAGG + Intergenic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096571959 12:52528693-52528715 GGGTAGAGATGGAGAGCATTTGG - Intergenic
1097057996 12:56261753-56261775 GTGGAGACATGGGAAGAAATCGG + Intergenic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097991771 12:65842832-65842854 GTTTAGTGATGGAAAGTATTTGG + Intronic
1098029839 12:66242398-66242420 ATCTAGAGCTGGAGAGAAGTCGG + Intronic
1098469371 12:70826103-70826125 ATGGAGAGAGGGAAAGAAGAAGG + Intronic
1098499471 12:71174085-71174107 TTGTAGTGATGAAAAAAAGTTGG - Intronic
1100085003 12:90900025-90900047 GTGGAGAGGTGGAAAGAGCTTGG - Intergenic
1101124190 12:101614212-101614234 GTGTAGTGATGGAAAGATAAAGG - Intronic
1101253598 12:102957275-102957297 GTGTATAGGTGGAAAGACTTGGG - Intronic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1103185918 12:118957176-118957198 CTGCAGAGATGGAAAAAACTAGG + Intergenic
1103226291 12:119290885-119290907 GTGTGGAGAGGGGAAGAAATTGG - Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1105765265 13:23553073-23553095 GTATATATATGGAGAGAAGTAGG - Intergenic
1106064743 13:26334903-26334925 GAATACAGATGGAAAGAAGTTGG - Intronic
1106968100 13:35098550-35098572 GTGTAGACATGGAATTAACTGGG + Intronic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1107700292 13:43040632-43040654 GTATAGAGAAGGAAAAAAGGGGG + Intronic
1108008386 13:45976154-45976176 GGGTAGAGATGGCAGAAAGTGGG - Intronic
1108637812 13:52352768-52352790 GGGTAGAGATGAAAAGACCTGGG + Intergenic
1109269077 13:60234240-60234262 GTGTCCAGCTGGGAAGAAGTGGG + Intergenic
1109326473 13:60873309-60873331 GTGTGGATAGGGAAAGAGGTTGG + Intergenic
1109881473 13:68483729-68483751 TTGTAGAGATTTAAGGAAGTTGG + Intergenic
1110592641 13:77282491-77282513 GTGAAGAGAAGGGAAGAAGATGG - Intronic
1110594736 13:77307810-77307832 GGGCAGGGATGTAAAGAAGTAGG - Intronic
1110706073 13:78602769-78602791 GTGGAGAGGGGGACAGAAGTAGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112219654 13:97474932-97474954 GTGTATATTTGGAAAGAAGTCGG - Intergenic
1113266597 13:108625092-108625114 TTGCACAGTTGGAAAGAAGTAGG - Intronic
1113771481 13:112911778-112911800 GTTTCTAGAAGGAAAGAAGTCGG - Intronic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114813259 14:25926323-25926345 GAGTAGAGTTGGAAGGCAGTTGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1116194313 14:41702865-41702887 GTTAAGAGAGAGAAAGAAGTTGG + Intronic
1116789284 14:49322551-49322573 GTGTATATATGGAAAGATGAAGG + Intergenic
1117261365 14:54037401-54037423 GTGGAGAGAGGGAGAGAAGCAGG - Intergenic
1119420966 14:74507917-74507939 GTGTAGAGATGGGCAGATGTGGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119711623 14:76826647-76826669 GTCGAGAGGTGGCAAGAAGTTGG + Intronic
1119956653 14:78805491-78805513 GTGCAGGGATGGAAGGTAGTAGG - Intronic
1120056259 14:79927670-79927692 GTGCTGAGGTGAAAAGAAGTAGG - Intergenic
1120254071 14:82096009-82096031 TTGTAGAGATATAAAGAAATAGG + Intergenic
1121031201 14:90660026-90660048 CTGTAAAGATGGAATGAGGTGGG + Intronic
1121745057 14:96282060-96282082 ATGTTGAGATAAAAAGAAGTTGG + Exonic
1123484807 15:20680943-20680965 GTGTAGACATGGAATTAACTGGG - Intergenic
1123537537 15:21250013-21250035 GTGTAGACATGGAATTAACTGGG - Intergenic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124933095 15:34143008-34143030 GTATAGAAATTGAAAGAAGAGGG - Intronic
1125149804 15:36519013-36519035 ATATAGAGAGGGAAATAAGTGGG + Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125362240 15:38876437-38876459 GTGTAGAGAGGGAAAACAATGGG + Intergenic
1125976667 15:43959592-43959614 GTCTAGGGATGTAAAGTAGTTGG - Intronic
1126140377 15:45432805-45432827 TTTTAGATATGGAAAGAGGTAGG + Intronic
1126493680 15:49266875-49266897 GTGTAGAGATGGGAAGAGGGTGG + Intronic
1128681009 15:69651616-69651638 TGGTACAGATAGAAAGAAGTAGG - Intergenic
1130040200 15:80399985-80400007 GTGGAGAGAAGGAAGGAAGGAGG - Intronic
1130726785 15:86447439-86447461 GAGGAGAGATGGAAAGAAACTGG + Intronic
1130770350 15:86917618-86917640 GCGTAGAGATTCAAAGCAGTTGG + Intronic
1131466568 15:92660357-92660379 GTGGAGAGATGGAAAGATCCAGG - Intronic
1134187127 16:12093267-12093289 GTGTTGGGATGGAAAGAACATGG + Intronic
1134356352 16:13485769-13485791 GTGGAGAGATGAAGAAAAGTTGG - Intergenic
1135248293 16:20876963-20876985 GAGGGGAGATGAAAAGAAGTGGG + Intronic
1137537373 16:49337578-49337600 GCAGAGAGATGGAAAGAACTAGG + Intergenic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1141268720 16:82520081-82520103 GTGGAAGCATGGAAAGAAGTGGG - Intergenic
1141360718 16:83392925-83392947 GTGAAGAGCTGGAAGGAAGTTGG + Intronic
1141789810 16:86226786-86226808 GGGTAGGGATGGAAAGGGGTGGG + Intergenic
1141794483 16:86261196-86261218 GTGGAAAGATGGAAAGAACATGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143311128 17:5990207-5990229 AAGTAGAGATGGAAAGAGGGAGG - Intronic
1144183801 17:12777163-12777185 GTGTATACATGGAAAGAAAAAGG - Intergenic
1145019507 17:19418393-19418415 TTGCACAGATGGGAAGAAGTTGG + Intergenic
1146766207 17:35524206-35524228 TTTTAGAGATGTTAAGAAGTTGG + Intronic
1147009151 17:37429798-37429820 GTTTAGAGATGGATAGAGGAAGG - Intronic
1147686127 17:42287935-42287957 CTGTAGAGAGGGGAAGAACTGGG - Intronic
1147991134 17:44334236-44334258 GAGTAGAGATGGCAAGAATCAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148882413 17:50739878-50739900 TTTTAGAGGTGGGAAGAAGTAGG + Intronic
1148891480 17:50810774-50810796 GTGAAGAGAGGGAAAGAAGGTGG + Intergenic
1149142366 17:53447798-53447820 CTGAATAGATGGAAAGTAGTAGG + Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149713182 17:58761475-58761497 GGGTAGAGCTGGGATGAAGTGGG - Intronic
1149869253 17:60168069-60168091 ATGTAGAGATGTAGAGATGTAGG + Intronic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150645712 17:66976389-66976411 ATGGAGGGATGGAAAGAAGTTGG - Intronic
1150904132 17:69318867-69318889 GTGTGGAGATGGCAACTAGTGGG + Intronic
1151245937 17:72794686-72794708 GTGAAGAGATGGGAAGAGGGAGG - Intronic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152035556 17:77870104-77870126 GTGTAGAGAAGGTAAGAAATTGG + Intergenic
1152703687 17:81832460-81832482 GTGTAGAGAGGGTGGGAAGTGGG - Intronic
1153476212 18:5501503-5501525 ATGTTGAGATCGAAAGGAGTGGG - Intronic
1153834091 18:8949037-8949059 GTGTAGAGGTGGAAAGAGACAGG + Intergenic
1153963341 18:10158761-10158783 GTGTAGAGGGGGAAAGAAAAAGG - Intergenic
1155528467 18:26741870-26741892 GTGGAGAGATGGAAAGAAGCCGG + Intergenic
1155650195 18:28132366-28132388 GTGGAGAGAAGGAAAGAAACTGG - Intronic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155965394 18:32030804-32030826 GTGGAAAGGTAGAAAGAAGTTGG + Intronic
1156761308 18:40594540-40594562 CAGTAGAGATGAAAAGATGTGGG - Intergenic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1157445246 18:47740204-47740226 GTGTAGAGATGAACAGAGGTTGG + Intergenic
1157726886 18:49971250-49971272 GAGTAGAGAGGGCGAGAAGTGGG + Intronic
1160052931 18:75454253-75454275 GTTTAGATATGAAAATAAGTTGG - Intergenic
1160266633 18:77344251-77344273 GAGACGGGATGGAAAGAAGTGGG - Intergenic
1161248686 19:3269123-3269145 GTGGAGAGAAGGAAGGAAGGTGG - Intronic
1161486580 19:4539031-4539053 CCGCAGAGATGGGAAGAAGTGGG - Intronic
1162233676 19:9287841-9287863 GTGGAGAAATGGGAAGATGTTGG + Intergenic
1163096661 19:15063023-15063045 GAGTAGAGATAAAAAGATGTAGG - Intergenic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163569646 19:18073394-18073416 ATGTAGAGGTGGCAGGAAGTGGG - Intronic
1164687101 19:30174080-30174102 GTGAAGAGATGGAAAGCTGGTGG + Intergenic
1165350182 19:35270835-35270857 GTGTTGAAATGGAAGGAAGAGGG + Intronic
1165481060 19:36064578-36064600 GTCTAGAGAAAAAAAGAAGTGGG - Intronic
1165984465 19:39755914-39755936 GAGTAGAGGGGGAAAGAGGTAGG - Intergenic
1166347670 19:42176637-42176659 GGGCAGGGATGGAAAGAAATGGG - Intronic
1167577645 19:50325487-50325509 GTGCAGAGCTGGGAAGTAGTGGG + Intronic
1167849739 19:52192235-52192257 GAGAAGAGATTGAAAGAAGGTGG + Intronic
1167910444 19:52697828-52697850 GTGTAGAGAAAGAAATAAGGGGG + Intergenic
1202646246 1_KI270706v1_random:144661-144683 GTAGAGAGAGGGAGAGAAGTAGG - Intergenic
925383437 2:3444930-3444952 GTGTTGAAATGTAAAAAAGTTGG - Intronic
926188887 2:10712499-10712521 GTGGGGAAATTGAAAGAAGTTGG + Intergenic
926602923 2:14865347-14865369 GAGTCTAGAGGGAAAGAAGTAGG + Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
928935028 2:36667222-36667244 GCTTAGAGATGGAAAAAAATGGG + Intergenic
928946318 2:36775076-36775098 GAGCAGAGATGGTAAGCAGTGGG - Intronic
929122905 2:38498160-38498182 GTGGAGGGATGGGAATAAGTGGG - Intergenic
929241738 2:39660517-39660539 GTGAATAGGTAGAAAGAAGTGGG + Intergenic
930569992 2:53074455-53074477 TTAGAGATATGGAAAGAAGTTGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930851086 2:55961290-55961312 CTGTAGATCTGGAAAGAAGTTGG + Intergenic
931102433 2:59017491-59017513 TTCTAGACATGGAAAGAAATGGG + Intergenic
931913703 2:66930086-66930108 GGGTTGTGATGGAAAGAACTTGG - Intergenic
931925283 2:67065690-67065712 GTATAGAGATAGTAAGGAGTAGG + Intergenic
932134547 2:69216961-69216983 GGGGAAAGATGGAAAGATGTGGG - Intronic
932727468 2:74191862-74191884 GTGTACAGTAAGAAAGAAGTGGG + Intergenic
933951742 2:87336463-87336485 CTCTAGAGATGGACAGATGTTGG - Intergenic
934134320 2:88981011-88981033 CTCTAGAGATGGACAGATGTTGG + Intergenic
934235984 2:90232778-90232800 CTCTAGAGATGGACAGATGTTGG - Intergenic
934988179 2:98902221-98902243 GTGTAGTCATGGACACAAGTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937096537 2:119239205-119239227 GTGTAGAGAGGGAAAGAGGAAGG - Intronic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
939941463 2:148356708-148356730 ATGGAGAGTTGGAAAGAACTGGG - Intronic
940186893 2:150995796-150995818 GTGTAGAAATTGAAAGACTTGGG + Intergenic
940261740 2:151787850-151787872 TTGTAGAGGTGGCAAGAAATGGG + Intergenic
941379800 2:164778814-164778836 GGGAAGAGAGGGAAAGAAATAGG + Intronic
945466911 2:210180742-210180764 GTGTAGAGATGGACAGAGTTAGG - Intergenic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946549686 2:220787818-220787840 GAGTAGAGTTGTAAAAAAGTAGG + Intergenic
946628195 2:221637580-221637602 GAGTGGACATGGAAAGAGGTGGG + Intergenic
947387731 2:229608710-229608732 GGGTAGAGAGGGAGGGAAGTGGG + Intronic
949086314 2:242158737-242158759 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170019168 20:11816709-11816731 GGGTAGAGATGAAAACAAATGGG - Intergenic
1170546513 20:17439430-17439452 GTGAAGAGATGGAGAAAAATGGG - Intronic
1170704333 20:18731689-18731711 ATGGAGAGAGGGAAAGTAGTAGG - Intronic
1170819818 20:19747514-19747536 GGTTAGAGATGGAATGGAGTGGG - Intergenic
1171073784 20:22102284-22102306 GTGTAGAGATGGAGGCATGTAGG + Intergenic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1171182001 20:23097925-23097947 GTGGGCAGATGGAAAGCAGTGGG - Intergenic
1172428364 20:34871614-34871636 GTGTAGAGGAGGAGAGAATTTGG + Intronic
1173516643 20:43669150-43669172 GTGTAGAGATGGAAGGGGGCGGG + Intronic
1174005189 20:47405018-47405040 GTGAAGAGATGGAAAGAATAAGG - Intergenic
1174164104 20:48572421-48572443 GTTTAGTCATGGAAAGAAATTGG + Intergenic
1174791460 20:53482271-53482293 GTTAAGAGATGTAAAGATGTTGG - Intronic
1174916743 20:54661476-54661498 GTAATGAGATGCAAAGAAGTGGG + Intergenic
1176605628 21:8828100-8828122 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178092336 21:29177929-29177951 GTGTAGACATGAAAAGAATGTGG + Intergenic
1178189820 21:30267509-30267531 GTGTGAAGATACAAAGAAGTTGG - Intergenic
1178604139 21:34020516-34020538 GAGTAGAGCTGGCAAGAAGGGGG + Intergenic
1178642568 21:34356856-34356878 GTGCAAAAATGGAAAGAACTAGG + Intergenic
1178974733 21:37210945-37210967 GAGGAGAGAAGGAAAGAAGAAGG + Intergenic
1180209374 21:46285724-46285746 CTGTAGAGATTGGAGGAAGTCGG - Intronic
1180347925 22:11719704-11719726 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
1180355703 22:11837806-11837828 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
1180382550 22:12154519-12154541 GTAGAGAGAGGGAGAGAAGTAGG - Intergenic
1182265101 22:29108362-29108384 GTGGAAAGATGGAAAGAATGTGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183553991 22:38510769-38510791 GTGGAGAGAAGGAAAGAACCTGG + Intergenic
1183713164 22:39518633-39518655 GTGTTGAGATATACAGAAGTTGG - Intergenic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
950685221 3:14612405-14612427 GTAGAGAGAAGGAAAGAATTGGG + Intergenic
951191155 3:19773049-19773071 ATGTAGGGAGGGAAAGAAGAAGG + Intergenic
951263369 3:20538965-20538987 CTGTAGTGAAGTAAAGAAGTTGG - Intergenic
951383711 3:22018943-22018965 GGGTAGAGACGGAAAGGAGTAGG - Intronic
951422344 3:22502225-22502247 GTGGGGAGATGGAAAGAAACAGG + Intergenic
951476455 3:23111625-23111647 CTGAAGAGATGGAAAGAACTTGG + Intergenic
951493812 3:23302590-23302612 TTCTAGAGCTGGAAAGTAGTAGG + Intronic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954798548 3:53173932-53173954 GGGTAGAGATGGACGGAAGACGG - Intronic
954835252 3:53461187-53461209 GGTTAGAGATGGAAAGAAAGGGG - Intergenic
954887386 3:53887757-53887779 CTGTAGGGATGCAAAGATGTGGG - Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956354302 3:68374079-68374101 GGGTAGAGATGCAAAGAGGAGGG - Intronic
956388940 3:68751127-68751149 GTGCAGAAATGAAAAGAAATGGG + Intronic
956411134 3:68980967-68980989 GGGAAGAAATGGAAAGAACTGGG - Intronic
957668039 3:83262163-83262185 TTCTAGAGATAGAACGAAGTTGG - Intergenic
958754523 3:98234726-98234748 GTGTGCAGAAGGAAAGAATTTGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960184963 3:114627092-114627114 GAGTAGAGTTGGAAAAGAGTGGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961870200 3:129982001-129982023 CTGAAGAGTTGGAAGGAAGTAGG - Intergenic
962286193 3:134087260-134087282 GTGTAGGTGTGGTAAGAAGTGGG + Intronic
962334600 3:134516021-134516043 GTGTAGAGAAAGAAAAAAGGGGG + Intronic
962828800 3:139121870-139121892 GTGAAGTGATGGAAAGAAATGGG - Intronic
963512399 3:146264082-146264104 GGGTAGAGAAGGAAAGAGGAAGG + Intergenic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
965627074 3:170691870-170691892 GTGGAGAGAAGGGAAGAAATGGG + Intronic
966021243 3:175213901-175213923 GTGTAGAGTTGTAAATAAATGGG - Intronic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
966165626 3:177013458-177013480 AGGCAGAGACGGAAAGAAGTGGG + Intergenic
966490689 3:180525365-180525387 GGGTAGAGACAGAAAGAATTTGG + Intergenic
967041785 3:185700225-185700247 GTACAGAGATGGAAACAAATGGG + Intronic
968040903 3:195588504-195588526 GCATACAGATGGAGAGAAGTGGG + Intergenic
969002713 4:3995025-3995047 GTAGAGAGAGGGAAAGAAATGGG + Intergenic
970150632 4:13086235-13086257 GTGTAGAGATGGAAATGGGAGGG - Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
971414175 4:26408326-26408348 GGTTAAAGATGGGAAGAAGTTGG + Intronic
972945254 4:44246409-44246431 TTGAAGAGATGGAAAACAGTGGG - Intronic
973372482 4:49262889-49262911 GTAGAGAGAGGGAGAGAAGTAGG - Intergenic
973388521 4:49532252-49532274 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
973756569 4:54080413-54080435 GGGAAGAGATGGGAAGATGTTGG + Intronic
974439619 4:61899322-61899344 TTGCAGAAATGGAAAGAGGTAGG - Intronic
975267778 4:72391461-72391483 GTGTAGACAGTGAAAGAAATTGG + Intronic
975955346 4:79830606-79830628 GGGTGGAGAAGGAAGGAAGTAGG - Intergenic
976008774 4:80461902-80461924 GTTTATAGATGGAGGGAAGTGGG - Intronic
976697139 4:87928785-87928807 GAGGAGAGATGGGAAGAAGTTGG + Intergenic
977134322 4:93283389-93283411 GAGCAGAGACGGAAAGAATTTGG - Intronic
977401139 4:96534130-96534152 GAGGAGAGAGAGAAAGAAGTGGG - Intergenic
978421288 4:108535869-108535891 GGGTGGAGAAGGAAGGAAGTTGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979238034 4:118423720-118423742 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
979309313 4:119183720-119183742 ATGTAAAGATGGAAAAAAGTGGG - Intronic
979452152 4:120885336-120885358 GTGAAGAGGTGGAAAAAACTTGG + Intronic
980108477 4:128611379-128611401 TTGAAGAGGTGGAAAGAAATGGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980964148 4:139504042-139504064 GTGGAAAGATGGGAAGAACTTGG + Intronic
981006272 4:139878653-139878675 GTCTGGAAATGGAATGAAGTTGG + Intronic
981781597 4:148436804-148436826 GTCTAGATATGGAAAGACGGTGG - Exonic
982921088 4:161276151-161276173 TTGTAAATATGGAAAGAAATTGG + Intergenic
983345188 4:166520363-166520385 CTGAAGAGATGGAAAGGTGTAGG + Intergenic
983831322 4:172330965-172330987 TTTTAGAGATGAAAATAAGTTGG - Intronic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
985207933 4:187560929-187560951 GGGTAGAAATGGAAAGATCTGGG - Intergenic
985778177 5:1856299-1856321 GGGGAGAGATGGAGAAAAGTAGG + Intergenic
986414278 5:7512456-7512478 TTGTAGGGATGGAAAGAATGAGG + Intronic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
990586640 5:57218083-57218105 GAGTAGAGAGGAAAAAAAGTGGG - Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
992233923 5:74688857-74688879 GAGCAGAGATGGAAAGAATATGG - Intronic
992582760 5:78198609-78198631 ATTTAGAGATGGATAAAAGTTGG - Intronic
993042962 5:82836282-82836304 GGGTAGAGATGGGAAGAATTTGG - Intergenic
993124376 5:83814630-83814652 GTAGGGAGATGAAAAGAAGTTGG + Intergenic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993844914 5:92929567-92929589 TGGTAGAGATAGAAAGAAGTGGG + Intergenic
994715174 5:103312501-103312523 GTGTAGAGCCAGAAAGAACTTGG + Intergenic
995272678 5:110240063-110240085 GGCAAGATATGGAAAGAAGTAGG + Intergenic
995446840 5:112254337-112254359 CTGCAAAGACGGAAAGAAGTCGG - Intronic
995455534 5:112347968-112347990 GTGCAGATATGGTAAGCAGTAGG - Intronic
995817386 5:116186577-116186599 GTGAAGAGAAGGTATGAAGTAGG - Intronic
995882318 5:116856977-116856999 ATGAAGAGATGGAAAGAAAAAGG - Intergenic
996589125 5:125126380-125126402 GTGGACAGATTTAAAGAAGTTGG + Intergenic
997663937 5:135612506-135612528 GTGGAGAGATGAAAAGAGGTGGG - Intergenic
998717487 5:144902122-144902144 TAGGAGAGAGGGAAAGAAGTAGG + Intergenic
998973130 5:147614483-147614505 CAGTAGAGATAAAAAGAAGTAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999083546 5:148866768-148866790 GTTTAGACATGGAAAGCATTAGG + Intergenic
999529457 5:152446394-152446416 GTGTAAGGAGGGAAAGAATTAGG - Intergenic
1000412931 5:160952781-160952803 ATGTCTAGAGGGAAAGAAGTAGG + Intergenic
1002715673 5:181225142-181225164 ACCTAGAGATGGAAAGAACTGGG + Intronic
1002738465 5:181415691-181415713 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1003291923 6:4787220-4787242 CTTTAGGGATGCAAAGAAGTAGG + Intronic
1005029467 6:21495245-21495267 GAGTAAAGAAAGAAAGAAGTGGG - Intergenic
1005150230 6:22740594-22740616 GTGTAAGAATGGGAAGAAGTTGG + Intergenic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1006575886 6:35045513-35045535 GTGTAGGGGTGGAAAGAACAAGG - Intronic
1007186425 6:39976040-39976062 GTGTAGAGCAGGAGACAAGTTGG + Intergenic
1007741004 6:44009509-44009531 GTCTATACATGGAAAGAAGAAGG + Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009345759 6:62611656-62611678 GAGGAGAGAAGGAAAGAAGATGG + Intergenic
1009974066 6:70654553-70654575 TTATAGAGATAGTAAGAAGTAGG - Intergenic
1010169443 6:72957630-72957652 GTGTAGACATGGAAGGAAACAGG - Intronic
1010583900 6:77634222-77634244 ATGGAGAGATGAAAAGAACTTGG + Intergenic
1010917826 6:81642236-81642258 GTTTAGAGATGAAAAGAAGAGGG + Intronic
1010960286 6:82137773-82137795 GTGGAATGATGGGAAGAAGTTGG - Intergenic
1011695518 6:89909295-89909317 TTGTAGAGATGAAAAGAATGTGG + Intergenic
1012570638 6:100723568-100723590 GTGTGGAAATGTAAAGAAGTAGG - Intronic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1014362435 6:120496822-120496844 GTGATGAGAGGAAAAGAAGTAGG - Intergenic
1014589867 6:123250896-123250918 GTGTAGTGTTGGAAAGAAGTGGG - Intronic
1015728754 6:136326546-136326568 GACTAGAGATGGAAACAAATCGG + Intergenic
1016182168 6:141160331-141160353 GTGTAAAGATGGAAAGGGGGTGG - Intergenic
1016272627 6:142306220-142306242 GTAGAGAGATGGAAAGTGGTAGG + Intronic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016434322 6:144020097-144020119 GTGGAGAGAGGGAGAGAAGGAGG - Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016934970 6:149442844-149442866 GTATAGTGAAGCAAAGAAGTAGG - Intergenic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017082144 6:150680299-150680321 GTGGAGTGATGGAAAAAAGGTGG + Intronic
1017584195 6:155902256-155902278 GTGTTGAGAGGAAAAGGAGTTGG - Intergenic
1018406614 6:163490776-163490798 TGGAAGAGATGGACAGAAGTGGG + Intronic
1018451787 6:163915683-163915705 TTGAACAGATGGGAAGAAGTTGG + Intergenic
1018564631 6:165138306-165138328 GTGCAGAGATGTAGAGATGTTGG + Intergenic
1019243568 6:170691244-170691266 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1019943340 7:4308274-4308296 GTGGAGAGAGGGAAAGGCGTGGG - Intergenic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1021473425 7:21032912-21032934 GAGTAGAGACTGAAAGAAGCGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022154122 7:27642100-27642122 GTGTGAAGAAGGAAAGAAGGTGG - Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023551203 7:41371699-41371721 ATGCAGAGTTGGAAAGAAATGGG - Intergenic
1024179436 7:46875634-46875656 GTGTAATGATAAAAAGAAGTTGG + Intergenic
1024487437 7:49934139-49934161 GTGAAGATATGAAAAGAACTGGG - Intronic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025074525 7:55931581-55931603 GAGGAGAGAGGGAAAGAAGGAGG - Intronic
1025074531 7:55931606-55931628 GAGGAGAGAGGGAAAGAAGGAGG - Intronic
1025213236 7:57033315-57033337 GAGTAGTGATGGGAAGAAGCTGG + Intergenic
1025658717 7:63543509-63543531 GAGTAGTGATGGGAAGAAGCTGG - Intergenic
1025888002 7:65616775-65616797 GTGAAAAGGTGGAAAGAAGAAGG - Intergenic
1025984603 7:66437658-66437680 GTGTAGAAATGGAAAATAGGTGG + Intergenic
1026030110 7:66785288-66785310 GTGTAGAAATGGAAAATAGGTGG - Intronic
1026561451 7:71453803-71453825 GTGCAGAGAAGGAGAGAAGGTGG - Intronic
1027207806 7:76116246-76116268 GTGTAGAAATGGAAAATAGGTGG + Intergenic
1027732429 7:81891800-81891822 GGGGAGAGATGGAGAGATGTTGG + Intergenic
1027840172 7:83299559-83299581 GTGGAGAGTTGGAAAGATGTTGG - Intergenic
1028210562 7:88069166-88069188 GAGAAGAGAGGGAAAGAGGTAGG - Intronic
1028366192 7:90035631-90035653 GTGTATAAATGAAAAGAAGATGG + Intergenic
1028795148 7:94894117-94894139 GTGTGGACATAGAAAGAAATGGG - Intergenic
1029478929 7:100801461-100801483 GTGCAGAAATGGAAAAAGGTTGG + Intergenic
1030557394 7:111043715-111043737 CTGTAGAGATGGCAGGAAGCAGG - Intronic
1031346043 7:120668289-120668311 GTGTCAAGATGTAAAGCAGTAGG + Intronic
1031854386 7:126904965-126904987 GTCAAAAGATGGAAAGAAGAAGG + Intronic
1033996066 7:147349836-147349858 GTTGAGAGATGGGAAGGAGTTGG + Intronic
1034111745 7:148544029-148544051 GTGTGGAGATGGGAAGAGATGGG + Intergenic
1035504554 8:116914-116936 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
1036985931 8:13531080-13531102 GTGAAGACATGGGAAGAAGGTGG + Intergenic
1037136086 8:15462637-15462659 GTATAGACATGGCAAAAAGTTGG + Intronic
1037725765 8:21481399-21481421 AAGTAGAGAAGGAAAGAAGAGGG + Intergenic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1039370445 8:36979022-36979044 GGGTAGAGATGAAAATAATTAGG - Intergenic
1039409665 8:37342283-37342305 AGGGAGAGCTGGAAAGAAGTGGG + Intergenic
1039435688 8:37557733-37557755 GTGTAGAGAAGGCGGGAAGTGGG - Intergenic
1039493434 8:37964583-37964605 GTCTAGTGATGGCAAGAAATCGG + Intronic
1040676102 8:49752130-49752152 GTGTAGCTCTGGAAAGAAATGGG - Intergenic
1041080750 8:54212743-54212765 GGGTAAAGATGGAAAGAACCTGG + Intergenic
1041841937 8:62282227-62282249 GTGCAGGGATGGAAATTAGTGGG - Intronic
1042398265 8:68316150-68316172 GTGTACAGATGGGGAGAATTGGG + Intronic
1042712478 8:71733871-71733893 GTCAAGAGCTGGAAAGGAGTTGG - Intergenic
1043196350 8:77297149-77297171 TAGTAGAGGTGGAAAGAAGCAGG - Intergenic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044780245 8:95736026-95736048 GTGCAGGGATGGAAATAAGCGGG - Intergenic
1044976295 8:97669006-97669028 GTTCAGAGAGGGTAAGAAGTGGG - Intronic
1045370623 8:101518753-101518775 TAGCAGAGATGGAAAGAACTTGG - Intronic
1046256070 8:111697439-111697461 GTGTAGAGTTGGGGAGAAGAGGG + Intergenic
1046326758 8:112658602-112658624 GTGTAGAGAAGGAAAGATAAAGG + Intronic
1046555617 8:115768930-115768952 GGGAAGAGAAGAAAAGAAGTAGG - Intronic
1047731084 8:127729046-127729068 GTGCAGAGTTGGTAAGAAATAGG + Intergenic
1048190204 8:132281580-132281602 AGGTGGAGATGGAATGAAGTAGG - Intronic
1048992036 8:139766145-139766167 GCGCAGAGATGGAAAGAAAGAGG + Intronic
1049012949 8:139899798-139899820 GTGTCGAGTTGGAATGAAGGAGG - Intronic
1049352149 8:142170132-142170154 GTGCAGAGAGGGAAGGAAATGGG - Intergenic
1049435908 8:142586153-142586175 GTGTGGAAATGGGAAGAAGCTGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050005631 9:1127106-1127128 ATGTAGAGATGAAAAGAACATGG + Intergenic
1050152933 9:2635111-2635133 ATGAAGAGATGGAAAGAAAATGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1052001518 9:23288013-23288035 TTGTGGAGCAGGAAAGAAGTTGG - Intergenic
1052574608 9:30276151-30276173 GTGAAGTGATGCAAAGATGTAGG - Intergenic
1052661578 9:31439704-31439726 GCTTAAAGATGGAAAGAACTTGG + Intergenic
1055033892 9:71797439-71797461 ATGAAGAGATGGAAAGAGGAAGG - Intronic
1055058471 9:72045281-72045303 GAGAAGAGAGAGAAAGAAGTAGG - Intergenic
1055090207 9:72356763-72356785 GTATTGGGGTGGAAAGAAGTTGG - Intronic
1055176249 9:73321143-73321165 GTGTTGGAATGGAAAGAACTAGG - Intergenic
1055406107 9:75975024-75975046 GTGAAGAGATTGAAAGATGCTGG + Intronic
1055748903 9:79482464-79482486 TTGTTGATTTGGAAAGAAGTGGG + Intergenic
1056032771 9:82570191-82570213 GTGTAGAGAAAAAAAGAAGGTGG + Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1057344423 9:94235781-94235803 GTGTTCAGATGGAAAGAAAGAGG + Intergenic
1058756706 9:108089270-108089292 GTCTAGAGATAGACAGAAGGAGG - Intergenic
1058993638 9:110278524-110278546 GTGTAGTAATGGAAACAATTTGG - Intergenic
1059729645 9:117044253-117044275 GTGTAGAGAAGGACATAAGAAGG + Intronic
1059768824 9:117408886-117408908 GCTTTGAGATGGAAAGAAGTGGG + Intronic
1059821850 9:117982476-117982498 CTAGAGAGATGGGAAGAAGTTGG - Intergenic
1061080945 9:128369911-128369933 GGGCAGAAATGGAATGAAGTTGG - Intergenic
1203553021 Un_KI270743v1:180108-180130 GTATAGAGAGGGAGAGAAGTAGG + Intergenic
1203603757 Un_KI270748v1:40467-40489 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1186162269 X:6789682-6789704 GTGAAGGGAAGGAAAGAAGGAGG + Intergenic
1186238146 X:7535874-7535896 GAGGAGAGGTGGGAAGAAGTTGG - Intergenic
1187506728 X:19884502-19884524 GTGCCAAGATGGATAGAAGTGGG + Intronic
1187815386 X:23225834-23225856 GTGTACAGAGGGAAAGAGATTGG - Intergenic
1188390181 X:29610285-29610307 TTGTTGAGATGGTAGGAAGTGGG + Intronic
1189684955 X:43554325-43554347 TTGTAGAAATGGACAGAGGTGGG - Intergenic
1190325750 X:49205886-49205908 GTATACTGAGGGAAAGAAGTAGG - Intronic
1192463602 X:71339246-71339268 ATATAGAGAAGGAAAGAAGAAGG - Intergenic
1192559292 X:72115142-72115164 GTGTTAACAGGGAAAGAAGTTGG - Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192695673 X:73413132-73413154 GTGGAGATATGGAAAGAGATTGG - Intergenic
1192911217 X:75606622-75606644 GTGTAGAACTGGATAAAAGTGGG + Intergenic
1192998544 X:76538656-76538678 GTGTACAGTTAGAAAGAAGTAGG - Intergenic
1193150456 X:78118983-78119005 GGGTAGAGAAGGATAGAAGATGG + Intronic
1193549852 X:82878664-82878686 GTGGAGAGATGGAATGGGGTGGG + Intergenic
1193563630 X:83050585-83050607 GTGTAGCAATGGTAAGAAGTGGG + Intergenic
1193669934 X:84372111-84372133 CTGTTGAGACAGAAAGAAGTGGG + Intronic
1194410004 X:93545708-93545730 ATGTAGTTATGGAAAGAATTGGG + Intergenic
1194794084 X:98188371-98188393 GTTCAGACATGGAAAGAAATTGG + Intergenic
1195393632 X:104388330-104388352 GGCTACAGATGGAAGGAAGTTGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195707030 X:107744542-107744564 GTGTAAGTATGGAAAGTAGTAGG - Intronic
1195756137 X:108200613-108200635 GGGGAGAGATGGAGAGAGGTTGG + Intronic
1196034497 X:111129540-111129562 GTGTTGAAATGGGAAGAAGGTGG + Intronic
1196468667 X:115999367-115999389 GAGTAGAGATGGAAGGGGGTAGG - Intergenic
1196539697 X:116893187-116893209 GGGTAGAGTGAGAAAGAAGTTGG + Intergenic
1196539796 X:116894222-116894244 GGGTAGAGTGAGAAAGAAGTTGG + Intergenic
1196786045 X:119422300-119422322 GTGTTAAGATGGGAAGAGGTAGG - Intronic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1198749924 X:139929276-139929298 GTTTTGAGGTGGAAAGAAATTGG - Intronic
1198793869 X:140375008-140375030 GTCTAGAGAGGGAAAGAAGCTGG + Intergenic
1198831925 X:140759920-140759942 GTTGAGAGAAGGAAGGAAGTTGG + Intergenic
1199284537 X:146041639-146041661 GGGTATAGATGGAGTGAAGTGGG + Intergenic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1202089289 Y:21172630-21172652 ATGTAGGGATAGGAAGAAGTTGG - Intergenic
1202385817 Y:24325519-24325541 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1202484969 Y:25344609-25344631 GTGGAGGGACAGAAAGAAGTGGG + Intergenic