ID: 1089552071

View in Genome Browser
Species Human (GRCh38)
Location 11:119287220-119287242
Sequence CTTGAAAAGCAGTCAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089552067_1089552071 11 Left 1089552067 11:119287186-119287208 CCTTTCGAGAGCATGAAATAAAG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089552071 11:119287220-119287242 CTTGAAAAGCAGTCAGTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 205
1089552066_1089552071 30 Left 1089552066 11:119287167-119287189 CCAGATGATTAGGTCGAAGCCTT 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1089552071 11:119287220-119287242 CTTGAAAAGCAGTCAGTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089552071 Original CRISPR CTTGAAAAGCAGTCAGTGGG TGG Intronic
901498882 1:9639262-9639284 CTTGAAAAGCACCTAGTGTGAGG - Intergenic
902979112 1:20110336-20110358 CCTGAAGAGAAGTCGGTGGGTGG + Intergenic
903134931 1:21303082-21303104 CTGGGAAAGCAGCCAGTGGTGGG - Intronic
904473505 1:30750161-30750183 CTTTAGGAGCAGCCAGTGGGGGG + Intronic
905129937 1:35746692-35746714 CTTGAAAAGAATTCCCTGGGCGG - Intronic
905288278 1:36901675-36901697 CTTGAAAAGCAGTGGGAGAGGGG - Intronic
905329954 1:37187542-37187564 CCTGCACAGCAGTGAGTGGGTGG - Intergenic
905565293 1:38959697-38959719 CTGGAAAAGCAGTGACTGTGGGG - Intergenic
905896168 1:41547367-41547389 GTTGACAAGCAGGCAGTGGCAGG + Intronic
907313212 1:53551725-53551747 CTTGAATGGCAGGCAGAGGGAGG - Intronic
907675551 1:56514785-56514807 CTTGAAAAGCACTGAGAGTGTGG - Intronic
907968335 1:59355801-59355823 CTTTAAAAGCAGGCAGTGAGAGG - Intronic
908273723 1:62447111-62447133 CTTTAAAAGAAGTCAGTTGTAGG - Intronic
909147579 1:71956829-71956851 CTGGAATAGCAGTTAGTTGGTGG - Intronic
910885148 1:91956315-91956337 CAGGAAAAGCAGGCAGGGGGTGG - Intronic
912486872 1:110035589-110035611 CTGCAAAAGGAGGCAGTGGGAGG - Intronic
916542751 1:165772831-165772853 CTTGAAAACCAGTTAGATGGTGG - Intronic
918543385 1:185655991-185656013 CTTGAAAAGGAGTCAGTTTTAGG - Intergenic
920538340 1:206756685-206756707 CTGGAAGAGCAGGCAGTTGGTGG + Intergenic
920642503 1:207766682-207766704 TTTAAAAAGCAGCCAGTGAGTGG + Intronic
1063068982 10:2640173-2640195 CGTGAGAAGGAGCCAGTGGGAGG + Intergenic
1063494437 10:6494000-6494022 CGTGAAAAGCAGTCAGACTGTGG - Intronic
1064368370 10:14728655-14728677 CTTGCAAAGCAGTCAGCTGTGGG + Intronic
1065201038 10:23313284-23313306 CTGGAAAATCAGACAATGGGTGG + Intronic
1067204359 10:44200513-44200535 CTAGAAAAGCAGTCATTAGTGGG + Intergenic
1069098723 10:64291317-64291339 CTTAAAAAGCAGTGAGAGAGAGG - Intergenic
1069294262 10:66824655-66824677 CTTCAAAAGCAGACAGTATGTGG + Intronic
1070713664 10:78701933-78701955 CTTGAAAAGCAGTGGGTGCCCGG - Intergenic
1071311709 10:84349092-84349114 TTTAAAAAGCAGTCTGTGGAAGG - Intronic
1072323698 10:94275524-94275546 TTTGAAAAGCAGACAGTCTGAGG - Intronic
1072423385 10:95308648-95308670 CTTGACAAGAATACAGTGGGAGG - Intergenic
1072600171 10:96918475-96918497 CTTGAAAAGTTGTCAGTGAAAGG + Intronic
1073167612 10:101471220-101471242 ATTAAAAAGCAGTCTGTGAGGGG + Intronic
1075598146 10:123747364-123747386 CTTGAAAAGCCATCAGTGCAGGG + Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1078593728 11:12668778-12668800 CTTGAAAAGGTGTCAGGGGTAGG + Intergenic
1079131918 11:17751783-17751805 CCTGAAGGGCAGTCAGTGAGTGG + Intronic
1085035081 11:73294987-73295009 CTGCAAATGCACTCAGTGGGTGG - Intronic
1085720574 11:78908922-78908944 CTTGACAAGTAGTCAGTGGTTGG + Intronic
1088137946 11:106579845-106579867 CTTGAAAATAAGTCAGTGTTAGG + Intergenic
1089027195 11:115283543-115283565 CTTAAACAGCACTCAGTGGATGG - Intronic
1089405530 11:118194353-118194375 CTTGAAAAAAAGTCAGGTGGGGG - Exonic
1089552071 11:119287220-119287242 CTTGAAAAGCAGTCAGTGGGTGG + Intronic
1089582034 11:119487306-119487328 CAGGAAGAGGAGTCAGTGGGAGG + Intergenic
1091174728 11:133547760-133547782 CCTGAGAAGCAGTCAGCTGGAGG - Intergenic
1092144204 12:6203412-6203434 CTTGAAAAGCAGGAATTGTGAGG + Intronic
1096003133 12:48145856-48145878 CTGGAGGAGCAGGCAGTGGGTGG + Exonic
1096601958 12:52735888-52735910 CTTGGGAAGCAGTCTGTGTGGGG - Intergenic
1096914163 12:55013758-55013780 CTGGGAAAGCAGCCAGTAGGGGG + Intergenic
1098514217 12:71355052-71355074 CTTGAGAATCAGTCTGTCGGAGG - Intronic
1098977109 12:76914043-76914065 CTTTAAAAGAAGTCAGCTGGTGG - Intergenic
1100703156 12:97169580-97169602 CAAGAAAAGCAGTCAATGTGTGG - Intergenic
1101320484 12:103669045-103669067 CTGGAAGAGCATTCAGAGGGAGG - Intronic
1102889336 12:116546187-116546209 TTTGAAAAGCAGTGTGGGGGCGG + Intergenic
1103560769 12:121792367-121792389 CAGGAGAAACAGTCAGTGGGAGG - Intronic
1108118596 13:47159391-47159413 CTTGCCAAGAAGTCAGTGGCAGG + Intergenic
1112570199 13:100587186-100587208 CTTGAAGTGAAGTCATTGGGAGG - Intronic
1115377764 14:32696830-32696852 CTGCAAAAGCTGTCAGGGGGAGG + Intronic
1116080109 14:40161439-40161461 CATGAAAAAGACTCAGTGGGAGG + Intergenic
1120010549 14:79408578-79408600 CTTCAAAAAAAGTCATTGGGTGG - Intronic
1121264555 14:92591570-92591592 CTTGAAAAAAAGCCAGAGGGGGG + Intronic
1121589117 14:95086825-95086847 CCTGAAAAGTAATCAGTGGTTGG + Exonic
1121849351 14:97205815-97205837 CAGGAACAGCAGTCATTGGGAGG - Intergenic
1122126308 14:99580403-99580425 CTGGAAAAGCAAGCAGAGGGCGG + Intronic
1122224794 14:100268402-100268424 TTTGAAAAGTGGTCAGTGAGTGG + Intronic
1122480641 14:102045004-102045026 ATTGAAAAGCAGTTACTGGCTGG + Intronic
1125517890 15:40333034-40333056 TTTGGAAGGCAGTGAGTGGGTGG - Intronic
1126594725 15:50373898-50373920 CTTGCATAGCAGTCTGTTGGTGG - Intergenic
1130376897 15:83337360-83337382 ATTGAAGAGCATTCAGTGGAGGG - Intergenic
1131020157 15:89090668-89090690 CGTTAAAAGCAGGCAGTGAGGGG + Intronic
1131318698 15:91366044-91366066 CTTGAAAAACCCACAGTGGGAGG + Intergenic
1131336876 15:91557638-91557660 TTTGAAAAGCCCTGAGTGGGAGG + Intergenic
1131358666 15:91769265-91769287 GTTGAAAAGCAGTAAGTGCAAGG + Intergenic
1133616682 16:7483476-7483498 CCTAAAAAGCAGTTAGTGTGTGG + Intronic
1133905765 16:10021125-10021147 TTTGGAGAGCAGTCACTGGGTGG + Intronic
1138242542 16:55439272-55439294 TTTGAAAAGCAGTCTGTGACAGG + Intronic
1140090661 16:71835827-71835849 CTTTGATACCAGTCAGTGGGAGG + Intergenic
1140751968 16:78033038-78033060 CTTGAGAAGCATTCAGTCTGAGG + Intronic
1141765163 16:86053287-86053309 GTTGATATGCAGTCAGAGGGTGG - Intergenic
1142552772 17:751367-751389 CCTGAAAAGCTGTCTGGGGGCGG + Intronic
1142966319 17:3583972-3583994 CTTAAAAAGAAGTCACTGGCCGG + Intronic
1144863336 17:18319337-18319359 CCTGAGAAGCACTCAGAGGGTGG + Intronic
1145287470 17:21516992-21517014 CTTGAAAAGCAGGTCGTGGAGGG - Intergenic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1148825194 17:50387945-50387967 CATGAAGAACAGTTAGTGGGCGG - Intronic
1148834369 17:50458063-50458085 CTTGAAAAACTGTCACTTGGAGG + Intronic
1149421574 17:56516102-56516124 TTTGAAAATCAGTCACTGGAGGG - Intergenic
1150219093 17:63485847-63485869 CTTAAAAATCAGTCTCTGGGAGG + Intronic
1151291803 17:73155965-73155987 CTTGAAAAGCTATCTGGGGGTGG - Intergenic
1152431121 17:80248724-80248746 CCTGAACAGCAGGGAGTGGGGGG - Intronic
1154040952 18:10855353-10855375 CTTGCATAGTAGTCATTGGGTGG + Exonic
1155842842 18:30667895-30667917 CTATGAAAGCAGTCAGTGGCTGG - Intergenic
1156600817 18:38604017-38604039 TATGAGAAGCAGTCAGTGAGTGG + Intergenic
1157313325 18:46568666-46568688 CATGAAAAGCAGTAATGGGGAGG - Intronic
1157964315 18:52190871-52190893 ATTGAATAGCAGTCAGTATGGGG - Intergenic
1158008450 18:52700517-52700539 CATGAAAAGGAGCCTGTGGGGGG - Intronic
1159129260 18:64261294-64261316 CTTGAAAATCACTGAATGGGAGG - Intergenic
1159470057 18:68841177-68841199 CTGGAATATCAGTGAGTGGGTGG + Intronic
1160450954 18:78965618-78965640 TTTGAGAAGCAGACAGTGCGGGG - Intergenic
1162070034 19:8147857-8147879 CTTGAAAAGCTTTGAGTGGGAGG + Intronic
1164186853 19:22878061-22878083 GTTGAAAAAAAGTCAGTTGGGGG - Intergenic
1165068400 19:33241702-33241724 CGTGAGAACCAGTCTGTGGGTGG + Intergenic
926763061 2:16296536-16296558 CTTAAAAGGCGGTCAGTGAGGGG - Intergenic
927614253 2:24574917-24574939 GTTGAAAACCAGTGATTGGGGGG - Intronic
928726827 2:34184012-34184034 GTTGAAGAGGAGTGAGTGGGAGG - Intergenic
929206298 2:39297975-39297997 CTGGAAAAGCATTTAGTGAGGGG + Intronic
931720372 2:65062982-65063004 CTTGGACAGAAGTGAGTGGGAGG + Intronic
932161042 2:69459796-69459818 CTTGAAAAGTAGTATGTGGTTGG - Intronic
936010014 2:108919651-108919673 CTAGAAAAGCAGTCAGGGCCAGG - Intronic
937699882 2:124852242-124852264 CTTGAAAAACAGTTAGATGGAGG + Intronic
939173683 2:138724900-138724922 GTTGAAAATCAGTCTGTGAGTGG + Intronic
941192109 2:162397636-162397658 CTTGAAAAGCAGGTAGTATGTGG - Intronic
942599485 2:177626394-177626416 ATTGAAAATCAGTCTGTGTGAGG - Exonic
943007179 2:182400082-182400104 CTTCAATAGTAGCCAGTGGGAGG - Intronic
943064170 2:183069642-183069664 CTTGGCAAGCAGGCAGTGGCGGG - Intergenic
943727482 2:191267160-191267182 CTTAAAAAGCTGTGAGTGGGAGG - Intronic
945987365 2:216365712-216365734 GTTTAAAAGCAGCTAGTGGGCGG - Intronic
946673178 2:222128412-222128434 GTGTCAAAGCAGTCAGTGGGAGG + Intergenic
947152736 2:227131449-227131471 CTTAAAAAGCAGACAGGGGCAGG - Intronic
947724700 2:232389544-232389566 CTGGAAAGGCAGTCTGCGGGGGG - Intergenic
1169223377 20:3840377-3840399 GTTAAAAAGCAGTCAGAGGCCGG + Intergenic
1169933195 20:10856091-10856113 CTGGACAAGTAGTCAGTGGAAGG + Intergenic
1171977560 20:31605199-31605221 GTTCAAAAGCAGCCAATGGGCGG - Intergenic
1175024178 20:55884044-55884066 CTTTAAATGCAGTCAGTTGAGGG - Intergenic
1177402082 21:20618141-20618163 CTAGAAATGAAGTCAATGGGTGG - Intergenic
1178047373 21:28710624-28710646 CTTAAAAAGCAGCCAGTGCTGGG + Intergenic
1178895125 21:36551400-36551422 CAAGAAAAGGAGGCAGTGGGAGG - Intronic
1179917023 21:44484412-44484434 CCTGAAAAGGAAACAGTGGGGGG - Intergenic
1181408148 22:22699564-22699586 CTTGACAAGCAGTGAGTACGGGG + Intergenic
1182474387 22:30568517-30568539 CTTGAAATCCAGTCAGTGTCTGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
950257682 3:11519515-11519537 CATGAAAGGCAGGCAGTGAGAGG + Intronic
951557893 3:23938990-23939012 CTTGGCAATCAGACAGTGGGTGG - Intronic
953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG + Intergenic
955451784 3:59076336-59076358 CTTGAGAGGCTGACAGTGGGAGG - Intergenic
955505658 3:59630645-59630667 CTTAGAAAGCACTGAGTGGGAGG - Intergenic
955812115 3:62802450-62802472 CTTGAAGAGGGGTGAGTGGGAGG - Intronic
956656437 3:71557657-71557679 CTTGAAGAGCAGAAAGTCGGAGG - Intronic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957364465 3:79204613-79204635 CCTGAAAAGCAATCTGTGGCAGG - Intronic
957378973 3:79399356-79399378 CTTGTTCAGAAGTCAGTGGGAGG - Intronic
957758653 3:84525393-84525415 TGTGTGAAGCAGTCAGTGGGAGG - Intergenic
957955017 3:87175365-87175387 TTTGGAAATCAGTAAGTGGGAGG - Intergenic
959459743 3:106610625-106610647 CTTGAGACGCAGTCCCTGGGTGG - Intergenic
960216315 3:115042632-115042654 TTTGTAAATCAGTAAGTGGGTGG - Intronic
961000363 3:123370114-123370136 CTATAAAAACAGCCAGTGGGAGG + Intronic
962082786 3:132158197-132158219 CTTGAAAATCAGTGATTGGAGGG - Intronic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
962594082 3:136922077-136922099 CTTAAAAACCACTCAGTGGCCGG - Intronic
963226686 3:142869441-142869463 CTTGCAAAGCTGTCTGTTGGGGG + Intronic
968186293 3:196635198-196635220 CTGGAAAAGCAGTCAGGGGTCGG + Intergenic
971258298 4:25032894-25032916 CTTGCACAGCAGTAAGTGGCAGG - Intergenic
972814417 4:42628487-42628509 CTTGGAAAGCTTTCAGTGGTTGG - Intronic
974479847 4:62428818-62428840 CTTGAATAGCAGGTATTGGGAGG + Intergenic
976012699 4:80510551-80510573 GTGGAAAAGCAGTCAGTGTTGGG - Intronic
976062334 4:81143315-81143337 CATGAAAAGCAGTCAATGAATGG + Intronic
977101013 4:92814992-92815014 ATTGTAGAGCAGGCAGTGGGGGG + Intronic
977180469 4:93867210-93867232 CTTGAAAAGCATTTACTGGAGGG - Intergenic
977457921 4:97284843-97284865 CTTACAAACCAGTCAGGGGGAGG - Intronic
977465145 4:97374498-97374520 GTTGAAAAGCATACAGTGAGAGG + Intronic
983350146 4:166576328-166576350 TTTGAAGTGCAGACAGTGGGAGG + Intergenic
988853308 5:35200445-35200467 TTTGTCCAGCAGTCAGTGGGAGG + Intronic
992199942 5:74373145-74373167 CTTGAAAAGGAGCCAGAGTGTGG - Intergenic
992501493 5:77348341-77348363 TTTGAAAAGAAATCAGAGGGTGG + Intronic
993011742 5:82491054-82491076 ACTGAAAAGGAGTCAATGGGAGG - Intergenic
995032544 5:107495962-107495984 CTGGACAAGCAGTCAGGAGGTGG - Intronic
997783387 5:136682909-136682931 TTTGAGAAGCAGCCAGTGGCAGG + Intergenic
999306702 5:150524220-150524242 GTTGAAAACAAGACAGTGGGTGG + Intronic
999418227 5:151418380-151418402 CATGAAAAGCAGCCAGGAGGGGG + Intergenic
1000185403 5:158853002-158853024 CTTAACCTGCAGTCAGTGGGTGG + Intronic
1000964891 5:167644459-167644481 GTTGAAAAAGAGTCAGTAGGTGG + Intronic
1003940139 6:11016347-11016369 TTTAAAAAGCAGTGAGTTGGTGG - Intronic
1004335108 6:14757329-14757351 CTTGACCAGCATTTAGTGGGAGG - Intergenic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1007205934 6:40151047-40151069 CTTAAAAAGCAGCCAGAGGTAGG - Intergenic
1007222361 6:40288936-40288958 CTTTATAAGGAGTCATTGGGGGG + Intergenic
1007744889 6:44037728-44037750 CTTGAAAAGCACTGTGTTGGAGG + Intergenic
1008668074 6:53737217-53737239 CATGAGAAGCATTCAGTAGGAGG + Intergenic
1009030314 6:58048971-58048993 CTTGTAAAACAGGGAGTGGGAGG + Intergenic
1009327868 6:62376148-62376170 CTTGAAAAGCAGTCCCTGGATGG + Intergenic
1009766201 6:68079093-68079115 CTAGAAAAGCAATCACTGAGAGG - Intergenic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1011262989 6:85487859-85487881 CTTGTAAAGCAGTATGTTGGTGG - Intronic
1014009191 6:116457636-116457658 CTTGGAAAGCAGCCTGAGGGAGG - Intergenic
1015834215 6:137402475-137402497 TTTGCATAGCAGTAAGTGGGTGG - Intergenic
1021564825 7:22006778-22006800 CTTGAAAATTAGCCAGGGGGAGG + Intergenic
1021901970 7:25294382-25294404 ATTGAACAGCAGGCAGTGGGTGG + Intergenic
1024574415 7:50752608-50752630 CTTGGAATGCAGTCAGGGGAGGG - Intronic
1028569172 7:92267024-92267046 CTTGATAAACAGTCAGGGAGTGG + Intronic
1031972321 7:128073793-128073815 TTAGAAAAGCAGTCAGTGCTAGG + Intronic
1034137481 7:148784243-148784265 TTTGAAAAACAGCCAGTGGGAGG - Intronic
1035408308 7:158616262-158616284 CTTCAAAATCAGCCAGTGGGTGG + Intergenic
1035766434 8:2109912-2109934 CATGGGAAGCTGTCAGTGGGGGG - Intronic
1040448056 8:47516103-47516125 CTTAAAAAGCAGACACTGGCCGG - Intronic
1040581276 8:48700464-48700486 TTCCAAAAGCTGTCAGTGGGAGG - Intergenic
1043397310 8:79851618-79851640 CTTGAGAAAGAGTAAGTGGGAGG - Intergenic
1044714378 8:95087274-95087296 TATAAGAAGCAGTCAGTGGGTGG - Intronic
1045109834 8:98929824-98929846 CTTGAAAAGCAGAAAGTGCTTGG + Intronic
1046685536 8:117221854-117221876 CATGGAAAGCACCCAGTGGGAGG + Intergenic
1048930612 8:139312633-139312655 TTTGCAAAGCAGTAAGTGTGAGG - Intergenic
1050927553 9:11284599-11284621 CCTGAAGAGAAGTCACTGGGTGG + Intergenic
1055148618 9:72966691-72966713 TTTAAAAAGCAGTCAATGGCCGG - Intronic
1056386222 9:86099399-86099421 CTCGAAAAGAGGTGAGTGGGCGG - Exonic
1061119888 9:128636007-128636029 CTTGGGAAGCCGTCAGTGGTAGG - Intronic
1062014720 9:134285306-134285328 CTTGAGAAGCACTTGGTGGGGGG - Intergenic
1185862440 X:3591992-3592014 CTTAAAAACCAGCCAGTGGCTGG - Intergenic
1188216758 X:27488631-27488653 CTTGAAAAACACCAAGTGGGAGG - Intergenic
1189128407 X:38472898-38472920 CTTCAAAAGAATTCAGTGGTGGG - Intronic
1189225459 X:39409666-39409688 CTTGAAAAGCAGGTAGAGGTCGG + Intergenic
1191129476 X:56993005-56993027 CTTGGAACACAGTCAGTGGTAGG - Intronic
1192079187 X:68031249-68031271 CTTCAAAGGCACTCAGTGAGGGG + Intergenic
1192101660 X:68271226-68271248 CTTGAAAAGCAGTAATTTGGTGG + Intronic
1192114413 X:68396872-68396894 CTTGATAAGTAGTAAGTGGCTGG + Intronic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1194848361 X:98839482-98839504 CATGAAAAGTAGACAGAGGGAGG - Intergenic
1196264619 X:113627594-113627616 TTTTAAAAGCAGTCAGAGGGAGG - Intergenic
1196376431 X:115038201-115038223 CGTGAAAAGAACTCAATGGGAGG + Intergenic
1197922795 X:131613102-131613124 CTGTAAAAACAGGCAGTGGGGGG - Intergenic
1198663396 X:138996036-138996058 CTTGAAAAGCAGTCTGGAGAGGG + Intronic