ID: 1089553627

View in Genome Browser
Species Human (GRCh38)
Location 11:119301694-119301716
Sequence CTTCTCTACATGGCATAAAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089553622_1089553627 29 Left 1089553622 11:119301642-119301664 CCAGAGTAGGCAGTACAGGATCT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG 0: 1
1: 0
2: 2
3: 19
4: 153
1089553621_1089553627 30 Left 1089553621 11:119301641-119301663 CCCAGAGTAGGCAGTACAGGATC 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG 0: 1
1: 0
2: 2
3: 19
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089553627 Original CRISPR CTTCTCTACATGGCATAAAG CGG Exonic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
900813437 1:4825636-4825658 CTACCCTACATGGTCTAAAGAGG + Intergenic
901903120 1:12384068-12384090 CTTCTCTACATTGCAGCCAGAGG - Intronic
903404288 1:23083398-23083420 CTTCCTTACATGGCAGAAACAGG - Exonic
904283203 1:29435817-29435839 CTTCTACTCATGGCAGAAAGTGG - Intergenic
905627985 1:39501037-39501059 CTTCAATTCATGGCAGAAAGTGG + Intronic
906574723 1:46877761-46877783 CTTCTCTTCATAGCTTAAAATGG - Intergenic
906597249 1:47090143-47090165 CTTCTCTTCATAGCTTAAAGTGG + Intronic
907184339 1:52598360-52598382 GTACTTTACATGGCATTAAGCGG - Intergenic
907305575 1:53511150-53511172 TTTATGTACATGGCAGAAAGAGG + Intronic
907534383 1:55136469-55136491 CTTCTCTACAGGGCACCCAGTGG - Intronic
909893558 1:81037363-81037385 CTTCTGTTCATGGCTTACAGAGG - Intergenic
911787698 1:101970998-101971020 CTCCTTTATATGGCATATAGAGG - Intronic
915668165 1:157463599-157463621 CTGCTCCACATGGCACAAAATGG - Intergenic
916383591 1:164241695-164241717 CTTTTATACATGGAATACAGTGG - Intergenic
918131472 1:181633379-181633401 CATCTCTACATTGCATGAATCGG - Intronic
918405177 1:184205376-184205398 CATCTAGACATGGCATAAAGTGG - Intergenic
922708207 1:227803222-227803244 CTTCTCTCTGTTGCATAAAGTGG + Intergenic
923867810 1:237959224-237959246 CTTCTATACTTGGCAAAAAGAGG + Intergenic
1066585876 10:36934763-36934785 CTTCTCTGTATGACAAAAAGAGG - Intergenic
1067243690 10:44518025-44518047 CTAGTCTACATGGTGTAAAGTGG - Intergenic
1071218012 10:83430149-83430171 CTTCTCTTCCTGGTACAAAGTGG + Intergenic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1074616358 10:115072795-115072817 CTTCTCTTCCTGGCACAAGGAGG + Intergenic
1077005289 11:352273-352295 TTTCTCTACATGGTCTAAAAGGG - Intergenic
1079399125 11:20091565-20091587 CTTCACTCCATGGCAGAAGGTGG - Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1080308890 11:30866941-30866963 CTTCCCCACAGGGCAGAAAGTGG - Intronic
1080811680 11:35710684-35710706 CTTCTCTTCCTGGTATAGAGAGG + Intronic
1080830952 11:35892818-35892840 TATCTCCACATGGCAGAAAGAGG - Intergenic
1088716472 11:112553977-112553999 CTTCCCTACATGGCCTCCAGGGG + Intergenic
1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG + Exonic
1092852340 12:12641048-12641070 TTTTTCTATATGGTATAAAGTGG + Intronic
1092870325 12:12800413-12800435 ATTCTCAACATAGCAGAAAGGGG - Intronic
1094784174 12:33826532-33826554 TTTCCCTAGATGGCCTAAAGAGG + Intergenic
1097842753 12:64337908-64337930 CTCCTCTCCCTGGTATAAAGAGG - Intronic
1098021779 12:66163493-66163515 CTTCTCATGATGGCAGAAAGGGG + Intronic
1098914787 12:76246063-76246085 TGTCCCTACATGGCAGAAAGTGG + Intergenic
1101755172 12:107615945-107615967 CTGCTCTGCATGGAATCAAGAGG - Intronic
1106332231 13:28749744-28749766 CTTCTGCTCATGGCAGAAAGTGG - Intergenic
1106875834 13:34071743-34071765 CTTGTCTTCCTGGTATAAAGAGG + Intergenic
1106910555 13:34458707-34458729 CTCCTCTACATGGCATAGTGTGG - Intergenic
1108461823 13:50674653-50674675 CTTCTCTGCTTGGGATAAGGAGG + Intronic
1109023871 13:57135382-57135404 TTTCTCTACATGGAGTAAGGTGG + Intergenic
1109518645 13:63478038-63478060 TTTGTCTACATGACATATAGTGG - Intergenic
1110433103 13:75448620-75448642 GTTCACTACAGAGCATAAAGTGG - Intronic
1110925525 13:81146478-81146500 CGTTTCTACATGGCATCAATTGG + Intergenic
1113397437 13:109961724-109961746 CTTGTCTACATTCCATAGAGGGG + Intergenic
1114785223 14:25589017-25589039 CTGCTCTACATGGCATTAGCAGG - Intergenic
1119527879 14:75336782-75336804 CTTCTTTGCATGCCATAAGGAGG + Intergenic
1119612930 14:76078927-76078949 CTTCTCTACAAGGCTAAATGGGG - Intronic
1120264523 14:82232386-82232408 GTGCTCAACATGGCATAGAGTGG - Intergenic
1131477342 15:92751339-92751361 CTTCACTCCATGGCTTAAAATGG + Intronic
1133395719 16:5445770-5445792 TTTTTCTAGATGGCTTAAAGAGG + Intergenic
1133566241 16:6996749-6996771 CTTTTCTACATGTCAGATAGAGG + Intronic
1134126439 16:11619362-11619384 CATCTCCACATGGCATGATGAGG + Intronic
1150101782 17:62430347-62430369 CTTATTTAAATGGCATAAAGAGG - Intronic
1153647761 18:7210639-7210661 CTTCTTCACATGGCAGAAATAGG + Intergenic
1155421747 18:25663841-25663863 ATTTTCTACATGGCATCAATTGG + Intergenic
1157558301 18:48627923-48627945 ATTCTCTACATAGCATTCAGAGG - Intronic
1158235699 18:55310821-55310843 TTTCCCTACAGGACATAAAGTGG - Intronic
1158303705 18:56081450-56081472 ATTCTCTACTTGGCATAAGAGGG - Intergenic
1162830778 19:13282944-13282966 ATTCTCTACATGGAATAGGGGGG - Intronic
1164069761 19:21756610-21756632 TTTCTATCCATGGCATAAAATGG - Intronic
1164263745 19:23594027-23594049 CTTCCCTGCATTACATAAAGTGG - Intronic
1165693734 19:37884586-37884608 CTTCTATATGTGGAATAAAGAGG - Intergenic
1166088486 19:40492606-40492628 GTTCTCCACATGGCAGAGAGAGG - Intronic
925178084 2:1798791-1798813 CAGCTCTCCAGGGCATAAAGCGG - Intronic
925328777 2:3042585-3042607 TGTCTCTACCTGGGATAAAGGGG - Intergenic
926540808 2:14178832-14178854 CAGCTCTACATGGCAAAAACTGG - Intergenic
927090150 2:19704496-19704518 CTTCTTTCCATGGCCTAAATGGG + Intergenic
927832663 2:26366178-26366200 CTTCTGTACATGTAATAAAATGG + Intronic
930134201 2:47884531-47884553 CTTCTCTAGAAATCATAAAGAGG - Intronic
930249387 2:49018496-49018518 CATCTCTTCCTTGCATAAAGAGG - Intronic
934776920 2:96945075-96945097 CTTCGCTAGATGGCAAAGAGAGG - Intronic
936680974 2:114770811-114770833 CTTCTCTACAAGGAATAATCAGG + Intronic
937477843 2:122230671-122230693 CTTCCCTGCATAGCATCAAGAGG + Intergenic
940829022 2:158447176-158447198 CCTCTCTACATTGCATAGACGGG + Intronic
943893632 2:193323894-193323916 CTTCTCTGCTTGGCATGAACTGG - Intergenic
944709457 2:202322725-202322747 CTTGTTTTCATGGCGTAAAGGGG + Intergenic
1169221123 20:3823665-3823687 CTTGGCCACATGGAATAAAGTGG + Intronic
1170993365 20:21326575-21326597 CTTCTCTACATGGCAATAGATGG + Exonic
1172866350 20:38101917-38101939 CTTGTCTACAAGCCATGAAGTGG + Intronic
1174819343 20:53713560-53713582 CTTCCCCAAATGGGATAAAGAGG + Intergenic
1183018101 22:35006503-35006525 TTTCTCTTCTTGGCATAAGGGGG - Intergenic
952176600 3:30870586-30870608 ATTCTCTACACGGCATCCAGAGG - Intronic
953369955 3:42379156-42379178 CTGCTCCACATGGCATCAACTGG + Intergenic
957228168 3:77475670-77475692 CTTCTTAACATTGCATAAATAGG + Intronic
957525138 3:81370939-81370961 CCTCTCTACTTGCCATCAAGAGG - Intergenic
957765604 3:84620906-84620928 CTTCTTTACATGGCAGCAACAGG + Intergenic
957880436 3:86205290-86205312 TTTCTCCATATGGCATAAATAGG + Intergenic
959451890 3:106515120-106515142 CTTTACTACATGGGATAAATTGG + Intergenic
959959411 3:112280041-112280063 CTCCTTTACATGTCATAAACAGG - Intronic
962716497 3:138130710-138130732 GTTCTCAACATGGTAAAAAGAGG + Intronic
963717303 3:148818391-148818413 CTTCTCTTCCTGGAACAAAGCGG + Intronic
964194659 3:154048560-154048582 CTTCTCCACATGGCATTGACTGG - Intergenic
965600785 3:170452740-170452762 TCTCTCTACATGGCATATATAGG - Intronic
965978957 3:174663473-174663495 CTTCTAGTCATGGCAGAAAGGGG + Intronic
966349601 3:179017552-179017574 TTTCTCTAAATGTCATACAGAGG - Exonic
966457784 3:180137235-180137257 CTTCTCTTCATGGTATAAAGAGG + Intergenic
966974833 3:185074435-185074457 CCTCTCTAAGTGGCATAATGTGG + Intergenic
970721403 4:18993436-18993458 CTTCTCTTCCTGGTATAGAGAGG + Intergenic
970979959 4:22084728-22084750 GTTCTAACCATGGCATAAAGGGG - Intergenic
974344479 4:60661651-60661673 TTTTTCTACATGGCAAAAAGGGG - Intergenic
976995824 4:91432123-91432145 CTTCTTTACAAGGCAGCAAGAGG - Intronic
979915881 4:126432635-126432657 CTTTTCTAAATGTCACAAAGAGG - Intergenic
980792862 4:137642211-137642233 TTTCTCTACATGGCACATAAAGG + Intergenic
981491948 4:145348885-145348907 CTTCTTCACATGGCAACAAGAGG - Intergenic
984557398 4:181231377-181231399 ATTCTCTACATAGCAAAAGGAGG - Intergenic
988260275 5:28877339-28877361 CTTCTCTACATGTCATATACTGG + Intergenic
989329505 5:40239996-40240018 CTCCTCTACATGCCTTCAAGAGG + Intergenic
989767278 5:45102534-45102556 CTTCCCTACATGACATAAGGTGG - Intergenic
990385870 5:55261495-55261517 CTTATCTACATGGGAAAAAGGGG + Exonic
990497907 5:56367252-56367274 TATCTCCACATGGCAGAAAGAGG + Intergenic
994099461 5:95877822-95877844 CATCTGTAAAAGGCATAAAGAGG + Intergenic
997287921 5:132696895-132696917 CTTCACTATCTGGCATAATGGGG - Intronic
997460376 5:134047718-134047740 CATCTCTACATTGCACAAACAGG - Intergenic
998725025 5:145002788-145002810 TATCTTTACATGGCAGAAAGAGG - Intergenic
998950877 5:147391919-147391941 CTTATCTTCATGGCACAGAGAGG + Exonic
1001947382 5:175791167-175791189 CTTCAATTCATGGCATAAAGTGG - Intergenic
1003804657 6:9713658-9713680 CTCCTTTATATGGCATAAACTGG - Intronic
1004967294 6:20868192-20868214 CTTTTCTACACGGCAGAAATAGG - Intronic
1006404551 6:33837203-33837225 CCTCTCCACATGGCACAAAATGG + Intergenic
1006922567 6:37636373-37636395 CTTATCTACTTGGCATGAAAGGG - Exonic
1007003428 6:38336456-38336478 CTTCTTCACATGGCAGAAGGAGG + Intronic
1012340791 6:98120599-98120621 CTTCTCTCTGTGGTATAAAGAGG - Intergenic
1014812059 6:125897977-125897999 CTACTCAACATGTCAAAAAGGGG - Intronic
1015083721 6:129261660-129261682 TTTCTATAAATGGCATAATGAGG - Intronic
1017975068 6:159349904-159349926 CCTCTTTTCATGGCAGAAAGGGG + Intergenic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1021103989 7:16616399-16616421 TTTCTCTACATTTCACAAAGAGG - Intronic
1021157761 7:17232835-17232857 CTTTTCTACATGGCATTATAAGG + Intergenic
1021476592 7:21068660-21068682 TTGCTCAACATGGTATAAAGTGG + Intergenic
1022288295 7:28976239-28976261 CTTCTGTACATGCCAGACAGAGG - Intergenic
1022579030 7:31529535-31529557 CTTCTCTACAAGAAAGAAAGTGG - Intronic
1023660413 7:42466021-42466043 CTTCTCTGCCTGGCATTCAGTGG - Intergenic
1024681380 7:51693222-51693244 GTTCTGGATATGGCATAAAGGGG - Intergenic
1028318523 7:89434137-89434159 CCACTCTACATGGCATCATGTGG + Intergenic
1030345646 7:108430259-108430281 CTTCTCAACATAGCAAACAGAGG - Intronic
1030815501 7:114031571-114031593 TGTCTTTACATGGCACAAAGAGG - Intronic
1032030927 7:128483211-128483233 CTTATTTAAATGGCATAAAGAGG - Intronic
1033867975 7:145715319-145715341 CTTATCTGCATGTCAGAAAGTGG - Intergenic
1034034419 7:147803731-147803753 CTTCTCTAAATGGCAGTAATTGG - Intronic
1034270762 7:149802570-149802592 CTTCTGTGCATGGCAGAGAGGGG + Intergenic
1037283078 8:17265397-17265419 CTTCTCTACTTAGAAAAAAGGGG + Intronic
1037761378 8:21744035-21744057 CATCTCTAAATGGCAGCAAGTGG - Intronic
1038000950 8:23390725-23390747 CTTCTCTGCAGCTCATAAAGGGG + Intronic
1041417125 8:57623153-57623175 CTATGCTACATGGCATAAAGAGG - Intergenic
1041527136 8:58819489-58819511 ATTTTCTACAAGCCATAAAGTGG + Intronic
1043030531 8:75128934-75128956 CTTTTCTTCTTGGGATAAAGTGG + Intergenic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1043794485 8:84519390-84519412 ATTCTCAACATGACATAAATAGG + Intronic
1044453080 8:92360914-92360936 CTTCTCTGTATGGCAATAAGTGG - Intergenic
1044461570 8:92451043-92451065 CTTTTCAAAATGGCATAAAAAGG - Intergenic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1047555673 8:125927254-125927276 CTTCTCTTCATGGCAAGAAGAGG + Intergenic
1047564885 8:126033425-126033447 CTTCTCTACAAGTCACAAAAGGG + Intergenic
1048225764 8:132583920-132583942 CTTCTCTACACTGCATATAGGGG - Intronic
1050080329 9:1909057-1909079 CTTCTCTACCTTGCAGAAATAGG - Intergenic
1051852520 9:21526320-21526342 CTTTTCTATATGGTATAAGGAGG + Intergenic
1055071168 9:72167517-72167539 TTTCTGAACATGGCAAAAAGTGG + Intronic
1056327671 9:85493502-85493524 CTTCTGAACTTGCCATAAAGGGG - Intergenic
1056642067 9:88379974-88379996 CTTTTCTTCCTGGCATAGAGAGG + Intergenic
1059136538 9:111812319-111812341 CTTTTTTACATGCCAGAAAGGGG - Intergenic
1061524687 9:131149635-131149657 CTGCTCTACATAGCAGCAAGAGG + Intronic
1188245644 X:27833081-27833103 CTTCCCAACCTGGTATAAAGAGG + Intergenic
1189992133 X:46605471-46605493 CTTCTCTGCATGGCACTCAGTGG + Exonic
1192585248 X:72313980-72314002 CTTCTCTCCATGGCACAGAGAGG + Intergenic
1194197878 X:90917875-90917897 CTGCTCTACTTGGCATAAGGTGG - Intergenic
1198530433 X:137546485-137546507 CTGCTCTGCATGCCAGAAAGAGG - Intergenic
1198577201 X:138023530-138023552 CTTATCTACATGGCTTATAAAGG - Intergenic
1198926847 X:141807206-141807228 TTTCTTTGCATGGCACAAAGTGG - Intergenic
1199569985 X:149257479-149257501 CTGCTCCACATGGCATCAACTGG + Intergenic
1200543860 Y:4494944-4494966 CTGCTCTACTTGGCATAAGGTGG + Intergenic
1201564286 Y:15349175-15349197 CTTCTCCACATTTAATAAAGAGG - Intergenic