ID: 1089554508

View in Genome Browser
Species Human (GRCh38)
Location 11:119308872-119308894
Sequence GGCTCCCATAGCCCTCTTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089554508_1089554511 -9 Left 1089554508 11:119308872-119308894 CCATCAAGAGGGCTATGGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1089554511 11:119308886-119308908 ATGGGAGCCAAGTGAACACGGGG 0: 1
1: 0
2: 0
3: 17
4: 149
1089554508_1089554510 -10 Left 1089554508 11:119308872-119308894 CCATCAAGAGGGCTATGGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1089554510 11:119308885-119308907 TATGGGAGCCAAGTGAACACGGG 0: 1
1: 0
2: 1
3: 15
4: 183
1089554508_1089554514 -1 Left 1089554508 11:119308872-119308894 CCATCAAGAGGGCTATGGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1089554514 11:119308894-119308916 CAAGTGAACACGGGGGATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 117
1089554508_1089554512 -8 Left 1089554508 11:119308872-119308894 CCATCAAGAGGGCTATGGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1089554512 11:119308887-119308909 TGGGAGCCAAGTGAACACGGGGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089554508 Original CRISPR GGCTCCCATAGCCCTCTTGA TGG (reversed) Exonic
900697787 1:4022994-4023016 GGCTCCCATTGCCTTCACGACGG - Intergenic
906566841 1:46806946-46806968 GGATGCCTCAGCCCTCTTGAGGG + Intronic
906671616 1:47659215-47659237 GGCTCTCTTAGCACTCTTCAAGG - Intergenic
908393222 1:63702414-63702436 GGCTGACATATCCCTCTGGAAGG - Intergenic
911106077 1:94132828-94132850 GGCTCCCATTGCCTTCCTTATGG + Intergenic
911755837 1:101555812-101555834 GGCTCTTCTAGCCCTCTTTAGGG + Intergenic
922622590 1:227001437-227001459 GGCTCCCATATCACTGCTGATGG - Intronic
1079101144 11:17543199-17543221 GGCTCCTATGGGCCTCTTTATGG + Intronic
1079130509 11:17744485-17744507 GGCTCCCCCAGCCCTCTGGCAGG + Intronic
1081048470 11:38307176-38307198 GGCTGCAATAAACCTCTTGAGGG + Intergenic
1083293005 11:61700154-61700176 GGCCCCCAGAGCCCTCCTGTTGG + Intronic
1085731949 11:79007609-79007631 GACACCCACAGCCCTCTGGAAGG - Intronic
1086957054 11:92944106-92944128 GGCTCTTCTAGGCCTCTTGAGGG - Intergenic
1086957608 11:92949771-92949793 GGCTCTTCTAGGCCTCTTGAGGG - Intergenic
1089031634 11:115336344-115336366 GGCTCCCAAATTCCTTTTGAGGG - Intronic
1089554508 11:119308872-119308894 GGCTCCCATAGCCCTCTTGATGG - Exonic
1091448418 12:558067-558089 GGCTGGCATAGACCTCGTGAAGG + Exonic
1098459734 12:70719675-70719697 GGCGCCCGTGGCCCTCTGGAAGG - Intronic
1103411020 12:120711125-120711147 GGCTCCCCCAGCCCTCTGGCAGG + Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104946863 12:132418889-132418911 GGCTCCTCTAGACCTCTTGGTGG + Intergenic
1108615296 13:52126990-52127012 GGCTCCTATGGCCCTCCTTAGGG - Intronic
1112924056 13:104651284-104651306 GATTCCCATAGCCCTCCTGGTGG + Intergenic
1120649535 14:87115105-87115127 GGCTCCTATAGCTCTCATAAAGG - Intergenic
1120875202 14:89368872-89368894 CTCTCCCATAGCCCTCTCGTTGG - Intronic
1124715175 15:32053109-32053131 ATCTCCCACAGCCCTCTTCAGGG - Intronic
1129105037 15:73301259-73301281 GCCTCCCCTAGACCTCATGAAGG - Intronic
1134022969 16:10934149-10934171 GACTCCCTGAGCCCTCTGGAAGG + Intronic
1144566583 17:16364413-16364435 GGTTCCTATACCCATCTTGATGG - Intergenic
1146804914 17:35857379-35857401 GGCTCCCAATGCCCTGTGGATGG - Intronic
1148147688 17:45376425-45376447 GGCTCCCCCAACCCTCCTGACGG + Intergenic
1152073016 17:78143464-78143486 GGCTCCAAGAGCCCTCCTGTGGG - Intergenic
1152781144 17:82227978-82228000 GCCTCCCCTTGCCCTCTGGAGGG + Intergenic
1153925109 18:9828406-9828428 GGCTCCCACAGCCTCCTTGGAGG - Intronic
1156875527 18:42005987-42006009 GGCTCCCATAACCCTCTCCTTGG + Intronic
1158285573 18:55877591-55877613 GCCTCCCATAACCCTCTAGCTGG - Intergenic
1160142841 18:76340631-76340653 GGCTTCCATAGCCTCCTGGAAGG + Intergenic
1161200065 19:3009627-3009649 GGCTCCCACAGCACTCTCAACGG - Exonic
1162960054 19:14120367-14120389 GGCCCCCAAAGTCCTCTAGATGG + Exonic
1167405048 19:49301241-49301263 GGCTCGCATAACCCTCTTTCAGG + Intronic
1168096761 19:54120232-54120254 GTGTCCCATAACCCTCTGGAGGG - Intronic
925854453 2:8116435-8116457 GGCTTCCAGAGCCTTCTGGAAGG - Intergenic
927707009 2:25302597-25302619 GGCACCCTGAGCCCTCATGAAGG - Intronic
928389100 2:30895425-30895447 GCCTCCCACAGCCCTCCTGCTGG + Intergenic
929042586 2:37759849-37759871 TGCTCCCTTAGCCCTGATGAAGG + Intergenic
929387981 2:41433916-41433938 GGCTCTCATAGCCCACCTAAAGG + Intergenic
929666597 2:43838600-43838622 GGCTCCCAGAGCTCCCTGGAGGG - Exonic
930297289 2:49570581-49570603 GGAGCCCATAGTCCTGTTGAGGG + Intergenic
930999099 2:57759962-57759984 GGCTCTCAGTGCCCTCTTGCTGG - Intergenic
933455207 2:82511155-82511177 GGCTCCAATACCTCTATTGATGG - Intergenic
937220806 2:120342491-120342513 GGCTCCCCTTCCCCTCCTGAGGG - Intergenic
941806167 2:169713743-169713765 GGCTATCATAGCCCCCTTGGGGG - Intronic
942231954 2:173868644-173868666 GGCTCACATACCCATCTGGAAGG + Intergenic
944414197 2:199467192-199467214 GACGCCCAGAGCCCTCTTGTTGG + Intronic
948937643 2:241178010-241178032 TGCTTCCTCAGCCCTCTTGATGG + Intronic
1169294366 20:4380726-4380748 GGCTGCCATTGCTCTCTAGAAGG + Intergenic
1184178984 22:42806449-42806471 GTCTCCCATATCCCTCTTCAGGG - Intronic
1185154415 22:49184478-49184500 GGCACCCACACCCCACTTGATGG + Intergenic
1185320278 22:50197504-50197526 CGCTGCGATGGCCCTCTTGAAGG - Exonic
955147424 3:56334062-56334084 GGATCCCATAGTCCACTAGATGG - Intronic
968744325 4:2351807-2351829 GGCTCCCATGGCCCCCTTCTGGG + Intronic
968912924 4:3485037-3485059 TGCCCCCACAGCCGTCTTGAGGG - Intronic
969315583 4:6379824-6379846 GGCTCACATAACCCTCCTCACGG - Intronic
982821216 4:159942338-159942360 GGCTCCCAAAGAGCTCTTAAGGG + Intergenic
984101707 4:175495185-175495207 CGCTCCCAGAGCCCTCCTGCAGG - Intergenic
986813491 5:11384329-11384351 GCATCCCATAGACCTGTTGATGG - Intronic
987066369 5:14293633-14293655 GGATCCCCTGGCCCTCTTTAAGG + Intronic
992335026 5:75758303-75758325 AGCTCACATAGCCTTCTTGTAGG + Intergenic
1000163463 5:158624150-158624172 TGCTCCCATAGCCCAGTTCAGGG + Intergenic
1004320360 6:14627057-14627079 AGCCCCCACAGCCCTCTTGGTGG - Intergenic
1012452440 6:99367052-99367074 GACTCACATAGTCCTCATGAAGG - Intergenic
1017377661 6:153789793-153789815 GCCTCCCATTCCCCTCATGAAGG + Intergenic
1017672500 6:156779589-156779611 GGCGCCCAAAGCCATCTTGACGG + Intronic
1018110882 6:160535948-160535970 ACCTCCCATAATCCTCTTGAAGG + Intronic
1019268520 7:132566-132588 GGCCTCCATAGCCATCGTGAAGG + Intergenic
1021463015 7:20910337-20910359 GGCTCCCATGACCCTCTTCTAGG - Intergenic
1022731891 7:33034340-33034362 GGGTCCTAGAGCCCTCTAGAAGG - Intronic
1026034958 7:66824272-66824294 AGCTGCCAGAGCCCTTTTGAGGG + Intergenic
1026984625 7:74546992-74547014 AGCTGCCAGAGCCCTTTTGAGGG - Intronic
1027214790 7:76176834-76176856 AGCTGCCAGAGCCCTTTTGAGGG - Intergenic
1037836359 8:22216938-22216960 GGCTCCCAGAGCCCTCATGGTGG - Intergenic
1040292737 8:46133689-46133711 GGCTCCAATTTCCCTCGTGAGGG + Intergenic
1047528768 8:125656678-125656700 GGCTCTAATAGCCCACTGGAGGG + Intergenic
1048281602 8:133109665-133109687 TGCTCCCATAACCATCCTGAGGG - Intronic
1049529407 8:143146931-143146953 GTCTTCCAGAGCCCTCTGGAGGG - Intergenic
1049612080 8:143560480-143560502 GGCACCCACAGACCTCTGGAGGG + Intronic
1049689434 8:143952289-143952311 GGTTCCCACAGCCCTCTGGCAGG + Intronic
1060892617 9:127198409-127198431 GGCTCTCTAAGCCCTCTTGGAGG - Intronic
1061374702 9:130217065-130217087 GGTTCTCATACCCCTCTTGTTGG - Intronic
1061504261 9:131022169-131022191 GACTCCCATAGCCCTCCTTACGG - Intronic
1186296448 X:8154124-8154146 GGCTCTTCTAGCCCTCTTTAGGG + Intergenic
1187111036 X:16300607-16300629 GGCTACCATAGACTACTTGATGG - Intergenic
1188441123 X:30215972-30215994 GCCTCCCAGAGCCGTCTTCAGGG - Intronic
1190654234 X:52597155-52597177 GGCTCCCAGTGCCTTCCTGAAGG + Intergenic
1193574649 X:83183252-83183274 GGCTCTAATAGCCATCTTGTGGG - Intergenic
1199723102 X:150557411-150557433 GACTCCCATAGCCCTTGTAATGG + Intergenic
1200696873 Y:6368821-6368843 GGCTCCCAAAGCCATCTCCATGG + Intergenic
1201037240 Y:9795878-9795900 GGCTCCCAAAGCCATCTCCATGG - Intergenic