ID: 1089555089

View in Genome Browser
Species Human (GRCh38)
Location 11:119311764-119311786
Sequence GAGACCAGGTCACCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 890}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089555089_1089555102 30 Left 1089555089 11:119311764-119311786 CCCACTTGGGGTGACCTGGTCTC 0: 1
1: 0
2: 2
3: 32
4: 890
Right 1089555102 11:119311817-119311839 CCACGTTGACCAGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 109
1089555089_1089555094 -9 Left 1089555089 11:119311764-119311786 CCCACTTGGGGTGACCTGGTCTC 0: 1
1: 0
2: 2
3: 32
4: 890
Right 1089555094 11:119311778-119311800 CCTGGTCTCTACCCAGAGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 188
1089555089_1089555095 -8 Left 1089555089 11:119311764-119311786 CCCACTTGGGGTGACCTGGTCTC 0: 1
1: 0
2: 2
3: 32
4: 890
Right 1089555095 11:119311779-119311801 CTGGTCTCTACCCAGAGGGAGGG 0: 1
1: 0
2: 3
3: 25
4: 252
1089555089_1089555098 7 Left 1089555089 11:119311764-119311786 CCCACTTGGGGTGACCTGGTCTC 0: 1
1: 0
2: 2
3: 32
4: 890
Right 1089555098 11:119311794-119311816 AGGGAGGGCCTCACCAAAAATGG 0: 1
1: 0
2: 5
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089555089 Original CRISPR GAGACCAGGTCACCCCAAGT GGG (reversed) Intronic
900013782 1:135861-135883 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
900065289 1:726847-726869 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
900826832 1:4933746-4933768 GAGACGAGGTATCACCAAGTTGG - Intergenic
901350279 1:8589251-8589273 GAGACCAGGTTTCACCATGTTGG - Intronic
901427938 1:9195047-9195069 GAGACCAGGTTTCACCATGTTGG - Intergenic
901483869 1:9544453-9544475 GAGACCAGGTTTCACCATGTTGG + Intronic
901489071 1:9587368-9587390 GAGACCAGGTTTCACCATGTTGG + Intergenic
901988451 1:13093409-13093431 GAGTCCTGGTCCTCCCAAGTTGG - Intergenic
901993361 1:13133358-13133380 GAGTCCTGGTCCTCCCAAGTTGG + Intergenic
902302853 1:15514817-15514839 GAGACAAGGTTTCCCCATGTTGG - Intronic
902651388 1:17839900-17839922 GAGACCTGGACAACCCCAGTGGG - Intergenic
902977576 1:20100024-20100046 GAGACCAGGTTTCACCATGTTGG - Intergenic
902982505 1:20135671-20135693 GAGACCAGGTTTCACCATGTTGG + Intergenic
903189219 1:21647272-21647294 GAGACAAGGTCTCACCATGTTGG - Intronic
903286584 1:22281174-22281196 GAGACGAGGTTTCCCCATGTTGG - Intergenic
903554332 1:24182011-24182033 GAGACGAGGTTTCACCAAGTTGG - Intronic
903618019 1:24676407-24676429 GAGACAAGGTTTCGCCAAGTTGG + Intergenic
903820612 1:26099686-26099708 GAGACAAGGTCTCACCATGTTGG - Intergenic
903899255 1:26631287-26631309 GAGACCAGGTTTCACTAAGTTGG + Intergenic
904140178 1:28346986-28347008 GAGACCAGGTTTCACCACGTTGG + Intergenic
904528068 1:31149526-31149548 GAGACCAGGTTTCACCACGTTGG + Intergenic
905104045 1:35552153-35552175 GAGACCAGGTTTCTCCATGTTGG - Intronic
905229496 1:36506036-36506058 GAGACCAGGTTTCACCATGTTGG + Intergenic
905318345 1:37097676-37097698 GGGACCAAGTCACTCCAGGTAGG - Intergenic
905398102 1:37680505-37680527 GAGACAAGGTCTCGCCATGTTGG - Intergenic
905441972 1:38001452-38001474 GAAACCAGGGCAACCCAAATAGG + Intronic
905747607 1:40432369-40432391 GAGACCAGGTTTCACCATGTTGG + Intergenic
905759834 1:40546107-40546129 GAGACCAGGTTTCACCATGTTGG + Intronic
906162328 1:43659503-43659525 GAGACCAGGTTTCACCATGTTGG + Intronic
906325091 1:44840522-44840544 GAGACCAGGTTTCACCATGTTGG - Intronic
906454820 1:45985278-45985300 GAGACCAGGTTTCACCATGTTGG + Intronic
906624726 1:47315542-47315564 GAGACCAGGTTTCACCATGTTGG + Intergenic
907022500 1:51082107-51082129 GAGACCAGGTTTCACCATGTTGG + Intergenic
907215256 1:52858208-52858230 GAGACCAGGTTTCACCATGTTGG - Intronic
908621891 1:65991265-65991287 GAGACGAGGTTTCCCCATGTTGG + Intronic
909024196 1:70463969-70463991 GAGACCAGGTTTCACCATGTTGG + Intergenic
909084549 1:71155513-71155535 GATACCAGCTCACCCACAGTAGG - Intergenic
910125415 1:83836595-83836617 AGGACCTGGTCACCCCAGGTAGG - Intergenic
911330085 1:96516943-96516965 GAGACGAGGTTTCCCCATGTTGG - Intergenic
912276376 1:108262479-108262501 GAGACCAGCTGATCCCAAGGAGG + Intergenic
912291852 1:108431879-108431901 GAGACCAGCTGATCCCAAGGAGG - Intronic
912540492 1:110411214-110411236 GAGACAGGGTCTCCCCACGTTGG - Intergenic
912670916 1:111623210-111623232 GAGACGAGGTTTCCCCATGTTGG + Intronic
912818122 1:112846231-112846253 GAGACCAGGTTTCACCATGTTGG + Intergenic
913285692 1:117224479-117224501 GAGACCAGGTTTCCCCTTGTTGG - Intergenic
913494143 1:119412335-119412357 GAGACAAGGTCTCACCATGTTGG - Intergenic
913588773 1:120302567-120302589 GAGACCAGGTTTCACCATGTTGG - Intergenic
913619412 1:120595802-120595824 GAGACCAGGTTTCACCATGTTGG + Intergenic
914691604 1:150033906-150033928 GAGACCAGGTTTCACCATGTTGG + Intergenic
914842104 1:151256933-151256955 GAGACCAGGTTTCTCCATGTTGG + Intronic
915238696 1:154503399-154503421 GAGACCAGGTTTCACCATGTTGG - Intronic
915379217 1:155425620-155425642 GAGACCAGGTTTCACCATGTTGG + Intronic
915622871 1:157096732-157096754 GAGACCAGGTTTCTCCATGTTGG - Intronic
915772354 1:158440691-158440713 GAGACCAGGTTTCACCATGTTGG - Intergenic
916029169 1:160861648-160861670 GAGACCAGGTTTCACCATGTTGG - Intronic
916360525 1:163962564-163962586 GATACCAGTTCACCCACAGTTGG + Intergenic
916443864 1:164854090-164854112 GAGACGAGGTCTCACCATGTTGG + Intronic
916950847 1:169778820-169778842 GAGACCAGGTTTCACCATGTTGG + Intronic
917008969 1:170449495-170449517 GAGACGAGGTCTCGCCATGTAGG - Intergenic
917428784 1:174943645-174943667 GAGACCAGGTTTCACCATGTTGG - Intronic
917781771 1:178404866-178404888 GAGACGAGGTCTCACCATGTTGG + Intronic
918013341 1:180608514-180608536 GAGACGAGGTTTCCCCATGTTGG - Intergenic
918187578 1:182141899-182141921 GAGACCAGGTTTCCCCATGTTGG + Intergenic
918281893 1:183014872-183014894 GAGACAAGGTCTCACCATGTTGG - Intergenic
918342385 1:183578550-183578572 GAGACCAGGTTTCACCATGTTGG + Intronic
918372542 1:183875687-183875709 GAGACCAGGTTTCACCATGTTGG - Intronic
918440727 1:184564492-184564514 GAGACCAGGTTTCACCATGTTGG + Intronic
919148023 1:193659585-193659607 GAGACCAGGTTTCTCCATGTTGG - Intergenic
919478138 1:198054347-198054369 GATACCAGCTCACCCACAGTAGG - Intergenic
919726403 1:200887617-200887639 GGGTCCAAGTCTCCCCAAGTGGG + Intergenic
919866120 1:201784342-201784364 GAGACCAGGTTTCACCATGTTGG + Intronic
920223830 1:204423970-204423992 GAGACCAGCTGACCCCCAGAAGG + Exonic
920429410 1:205907205-205907227 GAGACCAGGTTTCACCATGTTGG + Intergenic
920942683 1:210498954-210498976 GAGACCAGGTTTCACCATGTTGG + Intronic
922053900 1:222021994-222022016 GAGACCAGGTTTCACCATGTTGG + Intergenic
922938330 1:229437954-229437976 GAGACCAGGTTTCACCATGTTGG - Intergenic
923175268 1:231457605-231457627 GAGACCAGGTTTCACCATGTTGG - Intergenic
923395185 1:233554930-233554952 GAGACCAGGTTTCACCATGTTGG + Intergenic
923559776 1:235030257-235030279 GAGACCAGGTTTCACCATGTTGG + Intergenic
924375477 1:243403595-243403617 GAGGTCAGGTGACCCCGAGTTGG - Intronic
924512854 1:244742128-244742150 GAGACAGGGTCTCACCAAGTTGG - Intergenic
924629209 1:245721327-245721349 GGTACCAGCTCACCCAAAGTAGG + Intergenic
1063031123 10:2236335-2236357 GAAGCCATTTCACCCCAAGTTGG + Intergenic
1063569226 10:7199163-7199185 GAGACAAGGTCTCACCATGTTGG + Intronic
1063934759 10:11066081-11066103 GAGATCAGGCCACCGGAAGTGGG + Intronic
1064550612 10:16497119-16497141 GAGACGAGGTCTCACCATGTTGG + Intronic
1064653448 10:17533211-17533233 GAGACCAGGTTTCGCCATGTTGG - Intergenic
1064946782 10:20799340-20799362 GATACCAGGTCTCACCATGTTGG + Intronic
1064949845 10:20836407-20836429 GAGACCAGGTTTCACCACGTTGG + Intronic
1065050898 10:21789821-21789843 GAGACCAGGTTTCACCATGTTGG - Intronic
1065203576 10:23337345-23337367 GAGACAAGGTCTCGCCATGTTGG - Intronic
1065451100 10:25857831-25857853 GAGACCAGGTTTCACCATGTTGG - Intergenic
1065601930 10:27377846-27377868 GAGACGAGGTCTCACCATGTTGG + Intergenic
1065707323 10:28482507-28482529 GAGACCAGGTTTCACCATGTTGG - Intergenic
1065744570 10:28827905-28827927 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1065759246 10:28966551-28966573 GAGACCAGGTTTCACCATGTTGG - Intergenic
1065776609 10:29126162-29126184 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1065830931 10:29612987-29613009 GAGACCAGGTTTCACCATGTTGG - Intronic
1065862889 10:29886391-29886413 GGGACAAGGTCACACCATGTAGG + Intergenic
1065873368 10:29975385-29975407 GAGACGAGGTTTCACCAAGTTGG + Intergenic
1066122422 10:32302459-32302481 GAGATGGGGTCTCCCCAAGTTGG - Intronic
1066374606 10:34846339-34846361 GAGACCAGGTTGCACCATGTTGG + Intergenic
1067516518 10:46951179-46951201 GAGTCCAGGTTTCCCCATGTTGG + Intronic
1067645733 10:48100614-48100636 GAGTCCAGGTTTCCCCATGTTGG - Intergenic
1068113663 10:52711775-52711797 GAGACCAGGTTTCACCATGTTGG + Intergenic
1068690649 10:59910343-59910365 GAGACCAGGTTTCACCATGTTGG + Intergenic
1068772837 10:60841216-60841238 GAGATGAGGTTACCCCATGTTGG - Intergenic
1069006777 10:63326691-63326713 GAGACCAGGTTTCGCCATGTTGG - Intronic
1069041611 10:63701552-63701574 GAGACAAGGTTTCCCCATGTTGG + Intergenic
1069310800 10:67033956-67033978 GAGACCAGGTTTCCCCATGTTGG + Intronic
1069346022 10:67471000-67471022 GAGACCAGGTTTCACCATGTCGG + Intronic
1069391437 10:67940112-67940134 GAGACCAGGTTTCACCATGTTGG + Intronic
1069436306 10:68387168-68387190 GAGACCAGGTTTCACCATGTTGG - Intronic
1069555239 10:69393481-69393503 GAGACCAGGTTTCACCATGTTGG + Intronic
1070250577 10:74769538-74769560 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1070259844 10:74844383-74844405 GAGACCAGGTTTCACCATGTTGG + Intronic
1070608695 10:77918222-77918244 GAGACAAGGTTTCCCCATGTTGG - Intronic
1072336986 10:94405995-94406017 GAGACCAGGTTTCACCATGTTGG + Intronic
1072340722 10:94445759-94445781 GAGACCAGGTTTCACCATGTTGG - Intronic
1073089289 10:100920761-100920783 GAGACGAGGTCTCACCATGTTGG - Intronic
1073364257 10:102925108-102925130 GAGACAAGGTCTCTCCATGTTGG - Intronic
1073735719 10:106343800-106343822 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1074152646 10:110771313-110771335 GAGACCAGGTTTCGCCATGTTGG + Intronic
1074380018 10:112971797-112971819 GAGACGAGGTCTCACCATGTTGG + Intronic
1074612542 10:115036121-115036143 GAGACCAGGTTTCACCATGTTGG + Intergenic
1074668561 10:115759879-115759901 GAGACCAGGTTTCACCATGTTGG + Intronic
1074879614 10:117645513-117645535 GAGACCAGGCTTCACCAAGTTGG - Intergenic
1074926534 10:118078661-118078683 AAGACTAGCTTACCCCAAGTGGG - Intergenic
1075447791 10:122525938-122525960 GAGACCAGCTCACCCCCTGGTGG - Intergenic
1075984536 10:126772827-126772849 GAGACGAGGTCTCACCATGTTGG - Intergenic
1076019753 10:127062892-127062914 GAGACCAGGTCATCAAAAGAGGG - Intronic
1076970126 11:128075-128097 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
1077637125 11:3850776-3850798 GAGACCAGGTTTCACCATGTTGG + Intergenic
1078206999 11:9239016-9239038 GAGACCAGGTTTCACCATGTTGG + Intronic
1079497974 11:21067844-21067866 GAGACCAGGTTTCACCATGTTGG - Intronic
1079715861 11:23743701-23743723 GAGACCAGGTTTCACCATGTTGG + Intergenic
1080310733 11:30888920-30888942 TAGACCAGGTCTCCTCAGGTGGG + Intronic
1080807725 11:35670007-35670029 GAGACCAGGTTTCACCATGTTGG + Intronic
1081816279 11:45944947-45944969 GAGACCAGGTTTCGCCATGTTGG + Intronic
1081896113 11:46588144-46588166 GAGACCAGGTTTCACCATGTTGG - Intronic
1082012043 11:47456587-47456609 GAGACCAGGTTTCACCATGTTGG - Intergenic
1082074110 11:47963036-47963058 GAGACCAGGTTTCACCATGTTGG + Intergenic
1083027394 11:59562204-59562226 GAGACCAGGTTTCACCATGTTGG - Intergenic
1083141093 11:60722529-60722551 GAGACCAGGTTTCACCATGTCGG - Intergenic
1083278833 11:61613023-61613045 GAGACCAGGTTTCCCCATGTTGG + Intergenic
1083453023 11:62758985-62759007 GAGACCAGGTTTCACCATGTTGG - Intergenic
1083641123 11:64145954-64145976 GAGACCAGGTTTCACCATGTTGG + Intronic
1083788729 11:64970551-64970573 GAGACCAGGTTTCACCATGTTGG + Intronic
1083804369 11:65065472-65065494 GAGACCAGGTTTTCCCATGTTGG + Intergenic
1083947869 11:65935270-65935292 GAGACCAGGTTTCACCATGTTGG - Intergenic
1084114926 11:67036885-67036907 GAGACCAGGTTTCTCCATGTTGG - Intronic
1084134566 11:67166888-67166910 GAGACGAGGTCTCGCCACGTTGG - Intronic
1084202353 11:67569063-67569085 GAGACCAGGTTTCACCATGTTGG - Intergenic
1084362068 11:68675233-68675255 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1084382430 11:68821474-68821496 GAGACCTGGTTTCCCCACGTTGG + Intronic
1084419851 11:69054862-69054884 GAGACCAGGTGATCCCCAGGTGG - Intronic
1084564025 11:69919455-69919477 GGGACTTGGTCACCCCAAGGTGG - Intergenic
1085291957 11:75407322-75407344 GAGACCGGGTTTCCCCATGTTGG + Intronic
1085485042 11:76855930-76855952 GAGACCAGGTTTCACCATGTAGG - Intergenic
1085582974 11:77671818-77671840 GAGACAAGGTCTCACCATGTTGG + Intronic
1085596025 11:77810743-77810765 GAGACCAGGTTTCACCATGTTGG + Intronic
1087019340 11:93586750-93586772 GAGACCAGGTCAGTACAAGCTGG - Intergenic
1087034624 11:93743185-93743207 GAGACCAGGTTTCACCATGTTGG + Intronic
1087264106 11:96042306-96042328 GAGACCAGGTTTCTCCATGTTGG + Intronic
1087887527 11:103497611-103497633 GATACCAGGTCAGCCACAGTAGG + Intergenic
1088272635 11:108050552-108050574 GAGACCAGGTTTCACCATGTTGG + Intronic
1088292854 11:108260219-108260241 GAGACCAGGTTTCACCATGTTGG + Intronic
1088676972 11:112204038-112204060 GAGACCAGGTTTCACCATGTTGG + Intronic
1089555089 11:119311764-119311786 GAGACCAGGTCACCCCAAGTGGG - Intronic
1089822928 11:121245281-121245303 GAGACCAGGTTTCACCATGTTGG + Intergenic
1091400497 12:177910-177932 CAGACCCAGTCACCCCAAGATGG + Exonic
1091889575 12:4042678-4042700 GAGACAAGGTCTCACCATGTTGG - Intergenic
1092182736 12:6457345-6457367 GAGATCAGGTGACCTCAAGGAGG + Intronic
1092824858 12:12389322-12389344 GAGACCAGGTTTCTCCATGTTGG + Intronic
1092847203 12:12594935-12594957 GAGACCAGGTTTCACCATGTTGG - Intergenic
1092854899 12:12664174-12664196 GAGACCGGGTTTCCCCACGTTGG + Intronic
1093200158 12:16176967-16176989 GAGAACAAGTGACCCCAAATGGG - Intergenic
1093846582 12:23979408-23979430 GAGACCAGGTTTCACCATGTTGG + Intergenic
1094192291 12:27709999-27710021 GAGACCAGGTTTCTCCATGTTGG + Intergenic
1094545105 12:31397358-31397380 GAGACAAGGTTTCCCCATGTTGG - Intronic
1094680642 12:32664082-32664104 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1095199913 12:39371741-39371763 GAGACCAGGTTTCACCATGTTGG - Intronic
1096369676 12:51058606-51058628 GAGACCAGGTTTCTCCATGTTGG + Intronic
1096377106 12:51121650-51121672 GAGACGAGGTCTCACCATGTTGG + Intronic
1096391898 12:51236186-51236208 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1097060133 12:56277011-56277033 GAGACCAGGTTTCACCATGTTGG - Intronic
1097676791 12:62611615-62611637 GAGACCAGGTTTCACCATGTTGG - Intergenic
1098288850 12:68935475-68935497 GAGACCAGGTTTCACCATGTTGG + Intronic
1098635277 12:72776382-72776404 GAGACCAGGTTTCACCATGTTGG + Intergenic
1099255929 12:80311591-80311613 GAGACCGGGTCTCGCCATGTTGG + Intronic
1100161907 12:91870695-91870717 GAGACAGGGTCACTCCATGTTGG + Intergenic
1100833323 12:98539658-98539680 GAGACCAGGTTTCACCATGTTGG + Intronic
1100974626 12:100109575-100109597 GAGACCAGGTTTCACCATGTTGG - Intronic
1101173704 12:102126598-102126620 GAGACAAGGTTTCACCAAGTTGG - Intronic
1101429252 12:104613176-104613198 GAGACAGGGTCTCCCCAAGCTGG - Intronic
1101631431 12:106498770-106498792 GAGACGAGGTTTCGCCAAGTTGG + Intronic
1102080730 12:110096049-110096071 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1102119807 12:110431180-110431202 GAGACAAGGTTACACCATGTTGG - Intergenic
1102481066 12:113223728-113223750 GAGACCAGGTTTCGCCATGTTGG + Intronic
1102692689 12:114773734-114773756 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1102987591 12:117291024-117291046 GAGACAAGGTTTCACCAAGTTGG - Intronic
1103097474 12:118143700-118143722 GAGACCAGGTTTCACCATGTTGG - Intronic
1103333641 12:120172693-120172715 GAGACAAGGTTACACCATGTTGG + Intronic
1103762828 12:123263919-123263941 GAGACCAGGTTTCGCCATGTTGG - Intronic
1103893537 12:124257521-124257543 GAGACCAGGTTTCGCCATGTTGG + Intronic
1104439458 12:128782933-128782955 GAGACCAGGTTTCACCATGTTGG - Intergenic
1104539241 12:129646984-129647006 GAGACAGGGTCTCCCCATGTTGG + Intronic
1104566478 12:129889408-129889430 GAGTCCAGGTCAGCACAACTGGG - Intronic
1104955144 12:132460983-132461005 GAGACAAGGTCTCACCATGTTGG - Intergenic
1105656413 13:22444676-22444698 GAGACCAGGTTTCACCATGTTGG + Intergenic
1106306162 13:28512354-28512376 GAGACAAGGTTTCACCAAGTTGG + Intergenic
1106349216 13:28911360-28911382 GAGACCAGGTTTCACCATGTTGG + Intronic
1106664440 13:31836802-31836824 GAGACCAGGTTTCACCATGTTGG - Intergenic
1106679196 13:31992817-31992839 GAGACAAGGTTACACCATGTTGG + Intergenic
1107019927 13:35740872-35740894 GAGACCAGGTTTCTCCATGTTGG - Intergenic
1107485913 13:40827351-40827373 GAGACCAGGTTTCACCATGTTGG + Intergenic
1107872618 13:44761104-44761126 GAGACCAGGTTTCACCATGTTGG + Intergenic
1108289896 13:48948647-48948669 GAGACGAGGTTTCTCCAAGTTGG - Intergenic
1108342374 13:49510505-49510527 GAGACAAGGTCTCCCCAGGCTGG + Intronic
1108396305 13:49995287-49995309 GAGACCAGGTTTCACCATGTTGG + Intergenic
1108979274 13:56490150-56490172 GAGACCAGGTTTCACCATGTTGG - Intergenic
1109824265 13:67697368-67697390 GATACCAGCTCACCCAAAGTAGG + Intergenic
1109985970 13:69984920-69984942 GAGACCAGGTTTCTCCATGTTGG - Intronic
1110162475 13:72395382-72395404 GAGACCGGGTTTCCCCATGTTGG - Intergenic
1110736596 13:78944067-78944089 GAGACCAGGCCTCTCCATGTTGG - Intergenic
1110811141 13:79811671-79811693 GAAACCAGTTCTCCCCACGTTGG - Intergenic
1111098178 13:83542029-83542051 GAGACCAGGTTTCTCCATGTTGG + Intergenic
1111429735 13:88135640-88135662 GAGACCAGGTTTCACCATGTTGG + Intergenic
1113706924 13:112441109-112441131 GAGACCAGGTTTCCCCATGTTGG + Intergenic
1113781077 13:112977885-112977907 GAGACCAGGTTTCACCATGTTGG - Intronic
1114033435 14:18596841-18596863 GAGACCAGGTTTCCCTATGTTGG + Intergenic
1114078229 14:19176041-19176063 GAGACCAGGTTTCCCTATGTTGG + Intergenic
1114125265 14:19718510-19718532 GAGACCAGGTTTCCCTATGTTGG - Intergenic
1114458076 14:22869988-22870010 GAGACCAGGTTTCACCATGTTGG - Intergenic
1114496140 14:23133638-23133660 GAGACGAGGTTTCCCCATGTTGG - Intronic
1114905960 14:27126793-27126815 GAGACAAGGTTTCACCAAGTTGG + Intergenic
1115207401 14:30924476-30924498 GAGACAAGGTCTCACCATGTTGG + Intronic
1115553324 14:34524067-34524089 GAGACAGGGTCACACCATGTTGG - Intronic
1115573319 14:34687273-34687295 GAGACCAGGTTTCACCATGTTGG - Intergenic
1115996181 14:39198157-39198179 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1116020381 14:39453470-39453492 GAGACCAGGTTTCACCATGTTGG + Intergenic
1116602223 14:46940440-46940462 GAGACCAGGTTTCACCATGTTGG - Intronic
1116781960 14:49245783-49245805 GAGACCGGGTTTCACCAAGTTGG - Intergenic
1118357952 14:65030992-65031014 GAGACGAGGTCTCACCATGTTGG + Intronic
1118580806 14:67295296-67295318 GAGACCAGGTTTCACCATGTTGG - Intronic
1118884760 14:69857293-69857315 GAGACCAGGTTTCACCATGTTGG + Intronic
1118974117 14:70662842-70662864 GAGACCAGGTCACCACAACATGG + Intronic
1119644524 14:76338757-76338779 GAGACCAGGTTTCACCATGTTGG - Intronic
1119697076 14:76721617-76721639 GAGACGAGGTCTCACCATGTTGG + Intergenic
1121076734 14:91075327-91075349 GAGACAAGGTTACACCATGTTGG + Intronic
1121305184 14:92902127-92902149 GAGACCAGGTTTCACCATGTTGG + Intergenic
1121904275 14:97725267-97725289 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1122558451 14:102593523-102593545 GAGGCCAGGTCGCCCCCAGCAGG + Intronic
1122678741 14:103439593-103439615 GAGACCAGGTTTCACCATGTTGG + Intronic
1123416555 15:20099906-20099928 GAGACGAGGTTTCACCAAGTTGG + Intergenic
1123525893 15:21107011-21107033 GAGACGAGGTTTCACCAAGTTGG + Intergenic
1123588127 15:21776835-21776857 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1123624766 15:22219398-22219420 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1123944308 15:25231597-25231619 GAGAACAGGTTACCCCCAATAGG - Intergenic
1124061084 15:26294199-26294221 GAGCCCAGGGCACCCCCAGCTGG - Intergenic
1124366453 15:29075128-29075150 GAGTCCAGGTCAGGCCAAGTTGG + Intronic
1125166081 15:36706424-36706446 GAGACAAGGTTTCCCCATGTTGG - Intronic
1125805416 15:42489847-42489869 GAGACGAGGTCTCACCATGTTGG - Intronic
1125924885 15:43555021-43555043 GAGACAAGGTTTCCCCATGTTGG + Intronic
1125950859 15:43750200-43750222 GAGACCAGGTTTCACCATGTTGG + Intronic
1125950961 15:43750943-43750965 GAGACAAGGTTTCCCCATGTTGG - Intronic
1126165741 15:45652528-45652550 GAGACCAGGTTTCACCATGTTGG + Intronic
1126471995 15:49022411-49022433 GAGACCAGGTTTCACCATGTTGG - Intronic
1126778377 15:52118680-52118702 GAGACCAGGTTTCTCCATGTTGG - Exonic
1127350338 15:58145314-58145336 GAGACCAGGTTTCACCATGTTGG - Intronic
1127440362 15:59000523-59000545 GAGACAGGGTTTCCCCAAGTTGG - Intronic
1128304612 15:66589766-66589788 GAGACCAGGTTTCTCCATGTTGG - Intronic
1128349890 15:66881673-66881695 GAGCCCAGAGCACCCCATGTTGG + Intergenic
1128518586 15:68360535-68360557 GATTCCAGGGCACCCCATGTGGG - Intronic
1129415701 15:75377436-75377458 GAGATGAGGTCTCCCCATGTTGG - Intronic
1129756694 15:78103173-78103195 GAGACCAGGGCACTCCAGGGAGG + Intronic
1130096279 15:80858525-80858547 GAGACCAGGTTTCTCCATGTTGG - Intronic
1130153969 15:81333800-81333822 GAGACCAGGTTTCACCATGTTGG - Intronic
1130323485 15:82859487-82859509 GAGACCAGGTCTCCCAAGTTTGG - Intronic
1130998080 15:88915579-88915601 GGGACCAGGTTACACCATGTTGG - Intergenic
1131278359 15:91001127-91001149 GAGACAAGGTTTCCCCATGTTGG - Intronic
1131315169 15:91329308-91329330 GATACCAGGTCAGCCACAGTAGG - Intergenic
1131500674 15:92962066-92962088 GAGACGAGGTTTCACCAAGTTGG + Intronic
1131534880 15:93228344-93228366 GAGACCAGGTTTCTCCATGTTGG + Intergenic
1132920385 16:2386594-2386616 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1133245268 16:4444520-4444542 GAGACCAGGTTTCACCATGTTGG + Intronic
1133339247 16:5026113-5026135 GAGACCAGGTTTCACCATGTTGG + Intronic
1133449117 16:5888607-5888629 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1133553894 16:6886246-6886268 GAGACGAGGTCTCACCATGTTGG + Intronic
1133679386 16:8106707-8106729 GAGACGGGGTCCCCCCATGTTGG - Intergenic
1133920088 16:10144732-10144754 GAGACCAGGTTTCACCATGTTGG - Intronic
1134412074 16:14011439-14011461 GTGGCCAGGTCAGCTCAAGTGGG + Intergenic
1134673022 16:16069835-16069857 GAGACAAGGTTTCCCCATGTTGG - Intronic
1134810787 16:17165496-17165518 GAGACCAGGTTTCACCATGTTGG - Intronic
1135002781 16:18790732-18790754 GAGACGAGGTTTCCCCAAGTTGG + Intronic
1135219252 16:20599313-20599335 GAGACAAGGGCACCCCATGCAGG + Intergenic
1135648148 16:24181578-24181600 GAGACGAGGTCTCGCCATGTTGG - Intronic
1135680129 16:24449314-24449336 GAGACAAGGTTTCACCAAGTAGG + Intergenic
1135862015 16:26064801-26064823 GAGACGAGGTTTCCCCATGTTGG + Intronic
1136182933 16:28566854-28566876 GAGACCAGGTTTCACCATGTTGG + Intronic
1136240016 16:28937856-28937878 GAGGCCAGGTCACCCAAGCTGGG - Intronic
1136251338 16:29007492-29007514 GAGACCAGGTTTCACCATGTTGG - Intergenic
1136450092 16:30349468-30349490 GAGACTAGGTCTCACCATGTTGG - Intergenic
1136530934 16:30868597-30868619 GAGACCAGGTTTCTCCATGTTGG - Intronic
1137438881 16:48482303-48482325 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1137646764 16:50081759-50081781 AAGAGCAGTTCAACCCAAGTTGG + Intronic
1137774980 16:51046887-51046909 GAGACCAGGTTTCACCATGTTGG - Intergenic
1138371724 16:56532371-56532393 GAGACCAGGTTTCACCATGTTGG + Intergenic
1138391527 16:56673970-56673992 GAGACCAGGTTTCACCAAGTTGG - Intronic
1138407430 16:56807832-56807854 GAGACCAGGTTTCACCATGTTGG - Intronic
1138658407 16:58503670-58503692 GAGAACAGGATGCCCCAAGTAGG + Intronic
1138707358 16:58930270-58930292 GAGACGAGGTCTCACCATGTTGG + Intergenic
1139228255 16:65254342-65254364 GAGCCCAGATCCACCCAAGTGGG - Intergenic
1139911685 16:70401166-70401188 GAAACCAGGTCTCCCCAGGCAGG - Intronic
1140414400 16:74763442-74763464 GAGACGAGGTCTCACCATGTTGG + Intronic
1141104472 16:81222003-81222025 GAGACCAGGTTTCACCATGTTGG - Intergenic
1141360762 16:83393159-83393181 GAGACCATGTCACCCAGAGCTGG + Intronic
1141492645 16:84384861-84384883 GAGACCAGGTTTCACCATGTTGG - Intronic
1141506576 16:84482159-84482181 GAGCCACGGTCACCCCAACTGGG + Intronic
1141584650 16:85025594-85025616 GAGACCAGGTTTCACCATGTTGG + Intergenic
1142058579 16:88015596-88015618 GAGAACGGGTGACCCCAAGCAGG - Intronic
1142212447 16:88814917-88814939 GAGACAAGGGTTCCCCAAGTTGG + Intronic
1142386178 16:89766181-89766203 GAGACCAGGTTTCACCATGTTGG + Intronic
1142393988 16:89820845-89820867 GAGACCAGGTTTCTCCATGTTGG - Intronic
1142450551 16:90171057-90171079 GAGGCCAGGCCTCCTCAAGTTGG + Intergenic
1203092685 16_KI270728v1_random:1226642-1226664 GAGACCAGGTTTCACCATGTTGG + Intergenic
1142457010 17:62634-62656 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
1142516618 17:434561-434583 GAGACCAGGTTTCACCACGTTGG + Intergenic
1142571794 17:879471-879493 GAGACGGGGTCTCACCAAGTTGG + Intronic
1143021805 17:3920739-3920761 GAGACCAGGTTTCACCATGTTGG + Intergenic
1143078993 17:4367437-4367459 GAGACCAGGTTTCACCATGTTGG - Intergenic
1143270217 17:5669716-5669738 GAGACCAGGTTTCACCATGTTGG - Intergenic
1143450594 17:7034581-7034603 GAGACGAGGTCTCACCATGTTGG - Intergenic
1143485148 17:7250169-7250191 GACCCCAGGTCACCCCAACCTGG + Intronic
1144015583 17:11192138-11192160 GAGACCAGGTTTCACCATGTCGG - Intergenic
1144029965 17:11310784-11310806 GAGACCAGGTTTCACCATGTCGG - Intronic
1144357046 17:14456195-14456217 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1144512815 17:15892045-15892067 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1145749513 17:27345163-27345185 GAGAGCAGGTCATCCCAACGGGG + Intergenic
1146332725 17:31941441-31941463 GAGACAAGGTTTCCCCATGTTGG + Intronic
1147113461 17:38280860-38280882 GAGACCAGGTTTCACCATGTTGG + Intergenic
1147398166 17:40161490-40161512 GAGACCAGGTTTCACCATGTTGG - Intronic
1147677002 17:42213953-42213975 GAGACCAGGTCTCACCATGTTGG - Intronic
1147818484 17:43227670-43227692 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1147826935 17:43275706-43275728 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1147831768 17:43302372-43302394 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1147873332 17:43603112-43603134 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1147911366 17:43858154-43858176 CAGGCCTGGTCACCCCAAGGAGG + Intronic
1148099099 17:45076561-45076583 GAGACAGGGTCTCACCAAGTTGG - Intronic
1148374859 17:47133935-47133957 GAGACGAGGTTTCCCCATGTTGG + Intronic
1148416156 17:47508328-47508350 GAGACCAGGTTTCACCATGTTGG - Intergenic
1148532767 17:48410738-48410760 GAGACCAGGTTTCACCATGTTGG - Intronic
1148672621 17:49422280-49422302 GAGACCAGGTTTCTCCATGTTGG - Intronic
1148766529 17:50042455-50042477 GAGACAGGGTTTCCCCAAGTTGG - Intergenic
1149314171 17:55422772-55422794 GAGACAAGGTTTCACCAAGTTGG - Intergenic
1149465866 17:56878696-56878718 GAGACCAGGTTTCACCATGTTGG + Intergenic
1149686362 17:58537641-58537663 GAGACGAGGTTTCACCAAGTTGG - Intronic
1149766449 17:59282765-59282787 GAGACCAGGTTTCACCATGTTGG - Intergenic
1149944010 17:60901020-60901042 GAGACGAGGTTTCCCCATGTTGG - Intronic
1149984132 17:61334477-61334499 GAGACCAGGTTTCTCCACGTTGG - Intronic
1150237403 17:63604149-63604171 GAGACCAGGTTTCGCCATGTTGG - Intronic
1150932677 17:69602322-69602344 GAGACCAGGTTTCACCATGTTGG + Intergenic
1151132971 17:71917161-71917183 GAGAGCACTTCACCCCAATTTGG - Intergenic
1151257477 17:72890071-72890093 GAGACCAGGTTTCACCATGTTGG - Intronic
1151274302 17:73022406-73022428 GAGACCAGGTTTCGCCATGTTGG - Intronic
1151311099 17:73292902-73292924 GAGACCAGGTTTCACCATGTTGG + Intronic
1151406621 17:73891626-73891648 GAGACCAGGTTTCACCATGTTGG - Intergenic
1151606292 17:75138592-75138614 GAGACCAGGTTTCACCATGTTGG + Intronic
1151750457 17:76034291-76034313 GAGACGAGGTTTCACCAAGTTGG - Intergenic
1151789488 17:76295466-76295488 GAGACCAGGTTTCACCATGTTGG - Intronic
1151807574 17:76415616-76415638 GAGACCAGGTTTCACCATGTTGG - Intronic
1152444819 17:80335787-80335809 GAGACCAGGTTTCACCATGTTGG - Intronic
1152675824 17:81640634-81640656 GAGACAGGGTCACACCATGTTGG + Intronic
1152693309 17:81731627-81731649 GAGACGAGGTTACACCATGTTGG - Intergenic
1153617272 18:6946529-6946551 GAGACCAGGTTTCACCATGTTGG - Intronic
1153644766 18:7185430-7185452 GAGACGAGGTCTCACCATGTTGG + Intergenic
1153907240 18:9673036-9673058 GAGACCAGGTTTCACCATGTTGG - Intergenic
1153933993 18:9904485-9904507 GAGACGAGGTTCCCCCATGTTGG + Intergenic
1154154829 18:11935870-11935892 GAGACCAGGTTTCACCATGTTGG - Intergenic
1155548796 18:26942919-26942941 GAGACCAGGTTTCACCATGTTGG - Intronic
1156262703 18:35459680-35459702 GAGACAAGGTTTCCCCATGTTGG - Intronic
1156468978 18:37365670-37365692 GAGACCAGGTTTCACCATGTTGG + Intronic
1156496735 18:37530704-37530726 GTGACCAGGTCACCACCAGGAGG - Intronic
1156663465 18:39376489-39376511 GAGACCAGGTTTCACCATGTTGG - Intergenic
1157116637 18:44868506-44868528 GAGACGAGGTCTCTCCATGTTGG - Intronic
1157355596 18:46930912-46930934 GAGACCAGGTTTCACCATGTTGG - Intronic
1157943902 18:51957537-51957559 GAGACCAGGTTTCTCCATGTTGG - Intergenic
1158387753 18:57014137-57014159 GAGACAGGGTTTCCCCAAGTTGG - Intronic
1158462041 18:57654871-57654893 GAGACCAGGTTTCACCATGTCGG + Intronic
1158614871 18:58977661-58977683 GAGACAAGGTCTCACCATGTTGG - Intronic
1158713592 18:59858862-59858884 GAGACCAGGTTTCACCATGTTGG + Intergenic
1158952169 18:62504591-62504613 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1159088926 18:63824652-63824674 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1160214933 18:76920362-76920384 GAGACCAGGTTTCTCCATGTTGG - Intronic
1160234353 18:77074279-77074301 GAGCCCGGGTCTCCCCAAGGGGG + Intronic
1160496081 18:79376574-79376596 GAGACAAGGTTTCCCCATGTTGG + Intronic
1160646924 19:197993-198015 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
1160755665 19:755743-755765 GAGACGAGGTCTCACCATGTTGG - Intronic
1160759253 19:774657-774679 GAGACCAGGTTTCACCATGTTGG + Intergenic
1160789203 19:915443-915465 GAGACCAGGTTTCACCACGTTGG + Intergenic
1160789317 19:916205-916227 GAGACCAGGTTTCACCACGTTGG - Intergenic
1160852865 19:1202047-1202069 GAGACCAGGTTTCACCACGTTGG + Intronic
1161200165 19:3010175-3010197 GAGACCAGGTTTCACCATGTTGG - Intronic
1161449885 19:4339256-4339278 GAGACGAGGTTTCCCCATGTTGG + Intronic
1161472140 19:4463457-4463479 GAGACAAGGTCTCACCATGTTGG + Intergenic
1161660426 19:5542431-5542453 GAGACCAGGTTTCACCATGTTGG - Intergenic
1161682131 19:5685387-5685409 GAGACCAGGTTTCGCCATGTTGG - Intronic
1161723420 19:5915674-5915696 GAAGCCAGGTGACCCCAGGTGGG + Exonic
1161947438 19:7446552-7446574 GAGACCAGGTTTCACCATGTTGG - Intronic
1162038298 19:7954165-7954187 GAGACCAGGTTTCACCATGTTGG + Intergenic
1162147230 19:8620383-8620405 GGGACCAGGTCACAACAGGTGGG + Intergenic
1162189448 19:8933290-8933312 GAGACCAGGTTTCACCATGTTGG + Intronic
1162325853 19:9998869-9998891 GAGACCAGGTTTCACCATGTTGG + Intronic
1162433922 19:10645238-10645260 GAGACCAGGTTTCGCCATGTTGG + Intergenic
1162469966 19:10866974-10866996 GAGACAAGGTTTCACCAAGTTGG + Intronic
1162505573 19:11082428-11082450 GAGACGGGGTTACGCCAAGTTGG + Intergenic
1162959838 19:14118983-14119005 GAAGCCAGGTCACCCCGACTCGG + Intergenic
1163058938 19:14744051-14744073 GAGACCAGGTTTCACCATGTTGG - Intronic
1163059878 19:14752956-14752978 GAGACAGGGTCACACCATGTTGG + Intronic
1163265036 19:16215272-16215294 GAGACCAGGTTTCACCATGTTGG - Intronic
1163301651 19:16451135-16451157 GAGACCGGGTCTCACCACGTTGG + Intronic
1163340140 19:16700521-16700543 GAGACCAGGTTTCACCATGTTGG - Intergenic
1163372975 19:16912560-16912582 GAGACCAGGTTCCACCATGTTGG - Intronic
1163656660 19:18549968-18549990 GAGACCAGGTTTCACCATGTTGG - Intergenic
1163788317 19:19289559-19289581 GAGACGAGGTTTCACCAAGTTGG - Intronic
1163897395 19:20071445-20071467 GAGACCAGGTTTCACCACGTTGG - Intergenic
1164136734 19:22423223-22423245 GAGACCAGGTTTCACCATGTTGG + Intronic
1164213492 19:23121526-23121548 GAGACCAGGTTTCACCATGTTGG + Intronic
1164788431 19:30956317-30956339 GAGGCCAGGCGACCCCAAGTAGG - Intergenic
1164849368 19:31468830-31468852 GAGACGAGGTTACTCCATGTTGG + Intergenic
1164967608 19:32499089-32499111 GAGGCCAGGTGCCCCCAAGGAGG + Intergenic
1165584687 19:36903702-36903724 GAGACGAGGTTTCCCCATGTTGG - Intronic
1165682279 19:37788346-37788368 GAGACCAGGTTGCTCCATGTTGG - Intronic
1165988171 19:39788737-39788759 GAGACCAGGTTTCACCATGTTGG - Intergenic
1166112461 19:40630998-40631020 GAGACCAGGTTTCACCATGTTGG - Intergenic
1166293010 19:41875259-41875281 GAGACCAGGTTTCACCATGTTGG - Intergenic
1166399629 19:42468747-42468769 GAGACAAGGTTTCACCAAGTTGG - Intergenic
1166839884 19:45690643-45690665 GAGACCAGGTTTCACCATGTTGG - Intronic
1166925589 19:46264875-46264897 GAGACCAGGTTTCACCATGTTGG - Intergenic
1167059962 19:47138228-47138250 GAGACCAGGTTTCGCCATGTTGG + Intronic
1167188465 19:47965095-47965117 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1167191040 19:47989930-47989952 GAGACCAGGTTCCACCATGTTGG - Intronic
1167255067 19:48422422-48422444 GAGACCAGGTTTCACCATGTTGG - Intronic
1167283736 19:48586922-48586944 GAGACGAGGTCTCCCCATGTTGG - Intronic
1167559923 19:50220737-50220759 GAGACCAGGTTTCACCATGTTGG + Intronic
1167585699 19:50374188-50374210 GAGACCAGGTTTCAGCAAGTTGG + Intronic
1167616175 19:50535356-50535378 GAGACAAGGTTTCACCAAGTTGG + Intronic
1167737480 19:51304843-51304865 GAGACAGGGTCACGCCATGTTGG - Intergenic
1167759326 19:51435017-51435039 GAGACCAGGTTTCACCATGTTGG + Intergenic
1167904325 19:52646124-52646146 GAGACCAGGTTGCACCATGTTGG + Intronic
1168000392 19:53441093-53441115 GAGACCAGGTTTCACCATGTTGG - Intronic
1168004885 19:53478589-53478611 GAGACCAGGTTTCACCATGTTGG - Intronic
1168019635 19:53599790-53599812 GAGACCAGGTTTCACCATGTTGG - Exonic
1168160337 19:54506428-54506450 GACACCAGGGCACTCAAAGTGGG - Intronic
1168164884 19:54540195-54540217 GAGACCAGGTTTCACCATGTTGG + Intronic
1168343317 19:55638423-55638445 GAGACCAGGTTACACCGTGTTGG + Intronic
1168530522 19:57124693-57124715 GAGACCAGGTTTCACCATGTTGG + Intronic
1168619140 19:57863302-57863324 GAGACCAGGTTTCACCATGTTGG + Exonic
925418814 2:3693799-3693821 GAGACAAGGTTTCCCCATGTTGG - Intronic
925891296 2:8437252-8437274 GAGCCCTGGTCACTCCCAGTGGG + Intergenic
925899052 2:8495488-8495510 GAGGCCAGTTCACCACAAGACGG - Intergenic
926000895 2:9331579-9331601 GAGACCAGGTTTCACCATGTTGG - Intronic
926098124 2:10095803-10095825 GAGACGGGGTCTCCCCATGTTGG + Intergenic
927169560 2:20357447-20357469 GAGACCAGGTTTCTCCATGTTGG - Intergenic
927599504 2:24428301-24428323 GAGACAGGGTCTCACCAAGTTGG - Intergenic
928035848 2:27822352-27822374 GAGGAAAGGTCACACCAAGTTGG + Intronic
928132263 2:28661082-28661104 GAGACCAGGTTCCACCATGTTGG - Intergenic
928298372 2:30105069-30105091 GAGACCAGGTATCTCCATGTTGG + Intergenic
928370298 2:30735658-30735680 GAAACCAAGTGACCCCTAGTCGG + Intronic
928499188 2:31870762-31870784 GAGACCAGGTTTCACCATGTTGG + Intronic
928559719 2:32467587-32467609 GAGGCCAAGTCTCCACAAGTGGG - Exonic
928872054 2:35991464-35991486 GAGACGAGGTTACACCATGTTGG + Intergenic
929065400 2:37968252-37968274 GAGACCAGGTTTCACCATGTTGG - Intronic
929104207 2:38347951-38347973 GAGACAAGGTTTCCCCATGTTGG + Intronic
929978554 2:46657783-46657805 GAGACCAGGTTTCACCATGTTGG + Intergenic
930800852 2:55441146-55441168 GAGACGAGGTTTCACCAAGTTGG + Intergenic
931395263 2:61882695-61882717 GAGACAAGGTCTCGCCATGTTGG + Intronic
931619851 2:64198996-64199018 GAGACAGGGTTTCCCCAAGTTGG - Intergenic
932313258 2:70761420-70761442 GAGACCAGGTTTCACCATGTTGG - Intronic
933248893 2:80006504-80006526 GAGACCAGGTTTCTCCATGTTGG + Intronic
934971065 2:98764862-98764884 GAGACCAGGTTTCACCATGTTGG - Intergenic
935170533 2:100608272-100608294 GAGACCAGATAAGCCCCAGTGGG + Intergenic
935192912 2:100792937-100792959 GAGACGAGGTTTCCCCATGTTGG + Intergenic
935594519 2:104868548-104868570 GAGCCCAGGTCTGCCAAAGTTGG + Intergenic
935656845 2:105430478-105430500 GAGACGAGGTTACACCATGTTGG - Intronic
935658513 2:105445196-105445218 GAGACCAGGTTTCACCATGTTGG - Intergenic
936026761 2:109036955-109036977 GAGACGAGGTCTCACCATGTTGG - Intergenic
937769697 2:125706097-125706119 GAGACAAGGTTTCACCAAGTTGG + Intergenic
937918763 2:127115180-127115202 GAGACCAGGTTTCACCATGTTGG - Intergenic
938817105 2:134916290-134916312 GAGACAAGGTTTCCCCATGTTGG + Intergenic
939990424 2:148873372-148873394 GAGACCAGGTTTCACCAGGTTGG + Intergenic
940119550 2:150249093-150249115 GAGACCAGGTTTCACCATGTTGG + Intergenic
940292550 2:152091446-152091468 GAGACCAGGTTTCACCATGTTGG - Intronic
940918533 2:159284000-159284022 GAGACCGGGTTTCCCCATGTTGG + Intronic
941102515 2:161311799-161311821 GAGACCAGGTTTCGCCATGTTGG + Intronic
941113467 2:161444416-161444438 GAGACCAGGTTTCGCCATGTTGG + Intronic
941263078 2:163321307-163321329 GAGACCAGGTTTCACCATGTTGG - Intergenic
942207597 2:173636181-173636203 GAGACCAGGTTTCACCATGTTGG + Intergenic
943269278 2:185776908-185776930 GAGACCAGGTTTCGCCATGTTGG + Intronic
943640068 2:190347949-190347971 GAGACCAGGTTTCGCCATGTTGG - Intronic
944777231 2:202979068-202979090 GAGACCAGGTTTCACCATGTTGG - Intronic
945037789 2:205718753-205718775 GAGACCAGGTTTCGCCATGTTGG - Intronic
945081421 2:206089957-206089979 GAGACGGGGTTTCCCCAAGTTGG + Intergenic
945456035 2:210053408-210053430 GAGACAAGGTCTCACCATGTTGG - Intronic
946212136 2:218155820-218155842 GAGACCAGGTTTCACCATGTTGG + Intergenic
946564673 2:220950761-220950783 GAGACCGGGTCTCACCATGTTGG + Intergenic
946932139 2:224681167-224681189 GAGACAAGGTTTCCCCATGTTGG + Intergenic
947141228 2:227021051-227021073 GAGACAAGGTCTCACCATGTTGG + Intronic
947220549 2:227787755-227787777 GAGACCAGGACAGCCAATGTGGG + Intergenic
947504145 2:230694098-230694120 GAGACCAGGTTTCACCATGTTGG + Intergenic
947569122 2:231217395-231217417 GAGACGGGGTCTCCCCATGTTGG - Intronic
947621791 2:231595449-231595471 GAGACCAGGTTTCACCATGTTGG - Intergenic
948224842 2:236300839-236300861 GAGACCAGGTTTCACCATGTTGG + Intergenic
948262648 2:236615430-236615452 GAGACCAGCAGACCCAAAGTGGG - Intergenic
948999484 2:241604435-241604457 GAGACCAGGTTTCTCCATGTTGG + Intronic
1169062835 20:2673962-2673984 GAGACCAGGTTTCACCATGTTGG - Intergenic
1169884649 20:10385407-10385429 GAGACCAGGTTACACCATGTTGG + Intergenic
1169935869 20:10882669-10882691 GAGGTCAAGTCACCCCAGGTAGG - Intergenic
1170637391 20:18119129-18119151 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1170771454 20:19336570-19336592 GAGACCAGGTTTCACCATGTTGG + Intronic
1170794499 20:19534597-19534619 GAGACAAGGTTTCCCCATGTTGG + Intronic
1171933386 20:31248698-31248720 GAGACCAGGTTTCACCATGTTGG - Intergenic
1172102558 20:32494064-32494086 GAGACCAGGTTTCACCATGTTGG - Intronic
1172426692 20:34860352-34860374 GAGACCAGGTCACTGGAAGGGGG + Intronic
1172728598 20:37067580-37067602 GAGACCAGGTCTCACCGTGTTGG - Intronic
1172994632 20:39061028-39061050 GAGACGAGGTTTCACCAAGTTGG + Intergenic
1173789918 20:45821758-45821780 GAGACCAGGTTTCGCCATGTTGG - Intergenic
1174042526 20:47710086-47710108 GAGACCAGGTTTCACCATGTTGG + Intronic
1174263080 20:49311518-49311540 GAGACCAGGTTTCACCATGTTGG - Intergenic
1174623583 20:51895866-51895888 GAGACCAGGTTTCACCATGTTGG + Intergenic
1174629233 20:51941784-51941806 GAGACAAGGTCTCCCCAAGTTGG - Intergenic
1175355043 20:58358706-58358728 GAGACCAGGTTTCGCCATGTTGG - Intronic
1175758193 20:61543674-61543696 GTGACCAGGTGACCCCCAGGAGG + Intronic
1176003918 20:62848979-62849001 GAGACCAGGTTTCACCATGTTGG - Intronic
1176032313 20:63018469-63018491 GATACCAGCGCACCCCAAATCGG - Intergenic
1176106310 20:63390838-63390860 GAGACGAGGTTACACCATGTTGG - Intergenic
1176198382 20:63848258-63848280 CAGTCCAGGTCACCTCCAGTGGG + Intergenic
1178351473 21:31874933-31874955 GAGGCCGGGTCACCCCAGGCTGG + Intronic
1178545875 21:33492527-33492549 GAGACCAGGTTTCACCATGTTGG + Intergenic
1178884804 21:36476637-36476659 GAGACCAGGTTTCACCATGTTGG + Intronic
1178893167 21:36537002-36537024 GAGACGAGGTCTCTCCATGTTGG - Intronic
1178981065 21:37266102-37266124 GAGACCAGGTTTCACCATGTTGG + Intronic
1179577342 21:42316349-42316371 GAGACCAGGTGTCGCCATGTTGG + Intergenic
1179774582 21:43652946-43652968 GAGACCAGGTTTCACCACGTTGG - Intronic
1180457550 22:15523900-15523922 GAGACCAGGTTTCCCTATGTTGG + Intergenic
1180680574 22:17623482-17623504 GAGACCAGGTTTCACCATGTTGG - Intronic
1181016952 22:20076066-20076088 GAGACCAGGTTTCACCATGTTGG - Intergenic
1182336984 22:29590335-29590357 GAGACCAGGTTTCACCATGTTGG - Intergenic
1182362918 22:29757829-29757851 GAGACGAGGTTTCCCCATGTTGG - Intronic
1183410364 22:37651514-37651536 GAGACAGGGTTACCCCATGTTGG + Intronic
1183470294 22:38002034-38002056 GAGACCAGGTTTCACCATGTTGG + Intronic
1183631947 22:39038838-39038860 GAGACCAGGTCTCACCATGTTGG + Intergenic
1183637829 22:39075666-39075688 GAGACGAGGTCTCACCATGTTGG + Intronic
1183790915 22:40068502-40068524 GAGACGAGGTCTCACCATGTTGG + Intronic
1183941465 22:41298042-41298064 GAGACAAGGTTTCCCCATGTTGG + Intergenic
1184362909 22:44029587-44029609 GAGACCGGGTTTCCCCACGTTGG - Intronic
1184525958 22:45022967-45022989 GAGACAAGGTCTCACCATGTTGG + Intergenic
1184960147 22:47922763-47922785 GAGGCCAGGTCACGTCAGGTGGG - Intergenic
1185230871 22:49680883-49680905 GAGACCAGGTTTCACCATGTTGG - Intergenic
949324698 3:2850174-2850196 GAGACCAGGTTTCACCATGTTGG + Intronic
950091165 3:10295949-10295971 GAGACAAGGTCTCACCATGTCGG + Intronic
950218247 3:11174973-11174995 GAAACCAAGCCACACCAAGTGGG - Intronic
950491940 3:13310954-13310976 GAGACAGGGTCTCACCAAGTTGG + Intergenic
950775621 3:15347477-15347499 GAGACCAGGTTTCACCATGTTGG + Intergenic
950962569 3:17121058-17121080 GAGACGAGGTCTCACCATGTTGG + Intergenic
951240420 3:20280302-20280324 AAGATCAAGTCATCCCAAGTGGG + Intergenic
951622930 3:24625880-24625902 GAGACAAGGTTTCTCCAAGTTGG - Intergenic
951878807 3:27460218-27460240 GAGACCAGGTTTCTCCATGTTGG + Intronic
952907730 3:38153692-38153714 GAGACCAGGTTACCCATAATAGG + Intergenic
953029530 3:39169496-39169518 GAGACAAGGTCTCACCACGTTGG - Intergenic
953171012 3:40507276-40507298 GAGACCAGGTTTCACCATGTTGG + Intronic
953369220 3:42373018-42373040 GAGACAAGGTCTCACCATGTTGG - Intergenic
953611485 3:44450889-44450911 GAGACCAGGTAACACCAACCAGG - Exonic
953621104 3:44533642-44533664 GAGACGAGGTTACACCATGTTGG + Intergenic
953883233 3:46702086-46702108 GAGACGAGGGCATTCCAAGTTGG + Intronic
953948327 3:47167480-47167502 GAGACCAGGTTTCTCCATGTTGG - Intergenic
953957334 3:47241506-47241528 GAGACCAGGTTTCTCCATGTTGG + Intronic
954021213 3:47743624-47743646 GAGACCAGGTTTCTCCATGTTGG - Intronic
954045591 3:47926976-47926998 GAGACCAGGTTTCACCATGTTGG - Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954245716 3:49329951-49329973 GAGACCAGGTTTCACCATGTTGG - Intronic
954347535 3:50012927-50012949 GAGACCAGGTTCCTCCATGTTGG + Intronic
955185822 3:56714195-56714217 GAGACCAGGTTTCACCACGTTGG + Intergenic
955292902 3:57708713-57708735 GAGACTAGGTTACACCATGTTGG - Intergenic
955315259 3:57933235-57933257 GAGACAAGGTTTCCCCATGTTGG - Intergenic
955336148 3:58087924-58087946 GAGACAAGGTTACACCATGTTGG + Intronic
956291570 3:67666236-67666258 GAGACCAGGTTTCACCATGTTGG + Intergenic
956700850 3:71957214-71957236 GAGACAAGGTCTCACCATGTTGG - Intergenic
956815034 3:72900602-72900624 GAGACCAGGTTTCACCATGTTGG + Intronic
958069676 3:88593969-88593991 GAGACGGGGTCTCACCAAGTTGG - Intergenic
958123440 3:89324355-89324377 GAGACGAGGTTTCCCCATGTTGG + Intronic
958912817 3:100013428-100013450 GAGACCGGGTTTCCCCATGTTGG + Intronic
958917954 3:100070815-100070837 GAGACCGGGTCTCACCATGTTGG + Intronic
960116590 3:113900612-113900634 GAGACCAGGTTTCACCATGTTGG + Intronic
961473340 3:127132158-127132180 GAGACGGGGTCTCCCCATGTTGG - Intergenic
961726202 3:128932660-128932682 GAGGCCTGGGAACCCCAAGTTGG + Intronic
962544206 3:136415648-136415670 GAGACGAGGTTTCCCCATGTTGG - Intronic
962570041 3:136703821-136703843 GAGACCAGGTTTCACCATGTTGG - Intronic
963216414 3:142753576-142753598 GAGACGAGGTTTCACCAAGTTGG - Intronic
963424380 3:145107269-145107291 GAGACTAGGTTTCCCCATGTTGG - Intergenic
963461433 3:145618979-145619001 GAGACCAGGTTTCACCATGTTGG - Intergenic
966033015 3:175374365-175374387 GAGACAAGGTCTCACCATGTGGG - Intronic
966050652 3:175614237-175614259 GAGACCAGGTTTCACCATGTTGG + Intronic
966226595 3:177604575-177604597 GAGACCAGGTTTCACCATGTTGG - Intergenic
966854482 3:184184722-184184744 GAGACGAGGTTTCCCCATGTTGG - Intronic
966870633 3:184288120-184288142 GAGACCAGGTTTCACCATGTTGG - Intronic
967159904 3:186726474-186726496 GAGACAAGGTTTCCCCATGTCGG + Intronic
967164706 3:186770356-186770378 GAGACCAGGTTTCACCATGTTGG + Intergenic
967410598 3:189163083-189163105 GAGACCAGGTTTCACCATGTTGG - Intronic
967973967 3:195020709-195020731 GAGACAAGGTTTCCCCATGTTGG + Intergenic
968083979 3:195866385-195866407 GAGACCTGGTCTCGCCATGTTGG + Intronic
968209931 3:196840444-196840466 GAGACCAGGTTTCACCATGTTGG - Intergenic
968477581 4:819611-819633 GAAACCAAGTCTCCCCAAGTTGG + Intronic
968967746 4:3777615-3777637 GAGAGCACGAAACCCCAAGTGGG + Intergenic
969351619 4:6601315-6601337 GAGACGAGGTTTCCCCATGTTGG - Intronic
969845849 4:9919504-9919526 GAGACCAGCACCCCCCAAGGCGG - Intronic
971016972 4:22498430-22498452 GAGACGAGGTTTCACCAAGTTGG - Intronic
971780829 4:31032419-31032441 GAGACGAGGTCTCGCCATGTTGG - Intronic
972433836 4:39012617-39012639 GAGACCAGGTTTCACCATGTTGG - Intronic
973280932 4:48360402-48360424 GAGACCAGGTTTTCCCAAGTTGG - Intronic
973627735 4:52789841-52789863 GAGACCAGGTTTCACCATGTTGG + Intergenic
973726219 4:53778989-53779011 GAGACGAGGTTTCCCCATGTTGG + Intronic
973743932 4:53945438-53945460 GAGACTAGGTTTCACCAAGTTGG + Intronic
974474659 4:62362978-62363000 GAGACCAGGTTTCTCCATGTTGG + Intergenic
974862540 4:67540480-67540502 GAGACCAGGTTTCACCATGTTGG - Intronic
974961646 4:68709431-68709453 GAGACCAGGTTTCACCATGTTGG - Intergenic
975121091 4:70729442-70729464 GAGACGAGGTTTCCCCATGTTGG + Intronic
975368963 4:73561755-73561777 GAGACGGGGTTTCCCCAAGTTGG + Intergenic
976593723 4:86874823-86874845 GAGACCAGGTTTCACCATGTTGG - Intergenic
977597874 4:98903528-98903550 GAGACAAGGTCTCACCATGTTGG + Intronic
977807853 4:101323924-101323946 GAGACCAGGTTTCACCATGTTGG - Intronic
979326959 4:119391241-119391263 GAGACCAGGTTTCACCATGTTGG - Intergenic
979509992 4:121541501-121541523 GAGACCAGGTTTCACCATGTTGG - Intergenic
979523484 4:121694569-121694591 GAGACGAGGTCTCACCATGTTGG + Intronic
979603598 4:122613536-122613558 GAGACCAGGTTTCACCATGTTGG + Intronic
979674258 4:123394400-123394422 GAGACCAGGTTTCGCCATGTTGG + Intergenic
980114613 4:128667131-128667153 GAGACCAGGTCTTGCCATGTTGG - Intergenic
980250829 4:130312644-130312666 GAGACGGGGTCTCCCCATGTTGG - Intergenic
980511334 4:133792159-133792181 GAGACCAGGTTTCACCATGTTGG - Intergenic
980653096 4:135746595-135746617 GAGACGAGGTTTCCCCATGTTGG - Intergenic
980709235 4:136542435-136542457 GAGACCAGGTTTCACCAAGTTGG - Intergenic
980887432 4:138778716-138778738 GAGACGGGGTTTCCCCAAGTTGG + Intergenic
981836804 4:149064443-149064465 GATACCAGCTCAGCCAAAGTAGG + Intergenic
982007370 4:151076416-151076438 GAGACAAGGTTTCCCCACGTTGG + Intergenic
982289806 4:153768197-153768219 GAGACCAGGTTTCACCATGTTGG + Intergenic
982410057 4:155065008-155065030 GAGACGAGGTTTCCCCATGTTGG - Intergenic
983219104 4:165027296-165027318 GAGACGAGGTTTCCCCATGTTGG - Intergenic
984152544 4:176152406-176152428 GAGACAAGGTTTCCCCATGTTGG - Intronic
985295498 4:188433109-188433131 GAGACCAGGTTTCACCATGTTGG + Intergenic
985850252 5:2383410-2383432 GAGAGCAGGTGACCCTAAGGAGG - Intergenic
986304641 5:6506280-6506302 CAGACCAGGCGACCCCAAGCAGG - Intergenic
987384200 5:17313667-17313689 GAGACCAGGTTTCGCCATGTTGG - Intergenic
987522971 5:19011543-19011565 GAGACCAGGTTTCACCATGTTGG + Intergenic
987676202 5:21075732-21075754 GAGACCAGGTTTCGCCATGTTGG - Intergenic
987758467 5:22127289-22127311 GAGACCAGGTTTCACCATGTTGG - Intronic
988549903 5:32190980-32191002 GAGACCAGGTTTCACCATGTTGG + Intergenic
989384840 5:40845052-40845074 GAGACGAGGTTACACCATGTTGG + Intronic
990260854 5:54020758-54020780 GAGACCAGGTTTCACCATGTTGG - Intronic
990383372 5:55236152-55236174 GAGACCAGGTTTCACCATGTTGG + Intergenic
991568840 5:68033573-68033595 GAGACCAGGTTTCACCATGTTGG - Intergenic
991695424 5:69266400-69266422 GAGACCGGGTCTCACCATGTTGG - Intronic
991749223 5:69781426-69781448 GAGACCAGGTTTCACCATGTTGG - Intergenic
991800804 5:70361237-70361259 GAGACCAGGTTTCACCATGTTGG - Intergenic
991827796 5:70648804-70648826 GAGACCAGGTTTCACCATGTTGG + Intergenic
991893167 5:71360678-71360700 GAGACCAGGTTTCACCATGTTGG - Intergenic
991958133 5:72015993-72016015 GAGACCAGGTTTCACCATGTTGG + Intergenic
992458600 5:76939697-76939719 GAGACCAGGTTACACAATGTTGG + Intergenic
992834845 5:80630076-80630098 GAGACAAGGTTTCCCCATGTTGG - Intronic
992900776 5:81292837-81292859 GAGACCAGGTTTCACCATGTTGG - Intergenic
995041370 5:107591632-107591654 GAGACCAGGTTTCACCATGTTGG - Intronic
995567963 5:113451546-113451568 GAGACGAGGTCTCTCCATGTTGG - Intronic
996581864 5:125040107-125040129 GAGACAAGGTTACACCATGTTGG - Intergenic
996739086 5:126782734-126782756 GAGACCAGGTTTCACCATGTTGG + Intronic
997535619 5:134618809-134618831 GAGACCAGGTTTCGCCATGTTGG - Intronic
997912800 5:137892919-137892941 GAGACGAGGTTTCACCAAGTTGG - Intronic
997979945 5:138462848-138462870 GAGACCAGGTTTCACCATGTTGG - Intergenic
998531312 5:142887776-142887798 GAGACGAGGTCTCACCATGTTGG - Intronic
998629155 5:143879251-143879273 GAGACATGATCACCCCATGTAGG - Intergenic
999298947 5:150478537-150478559 GAGACCAGGTTTCACCATGTTGG + Intergenic
1000356204 5:160398361-160398383 GAGACGAGGTTTCGCCAAGTTGG - Intronic
1000460000 5:161503520-161503542 GAGACGAGGTTTCTCCAAGTTGG - Intronic
1000851091 5:166341076-166341098 GAGACCAGGTTTCACCATGTTGG - Intergenic
1001151019 5:169227117-169227139 GAGACAGGGCCACCCCTAGTGGG + Intronic
1001160672 5:169309987-169310009 GAGACGGGGTTTCCCCAAGTTGG - Intergenic
1001455066 5:171853962-171853984 GAGACCAGGTTTCACCATGTTGG - Intergenic
1001618365 5:173060415-173060437 GAGACAAGGTTTCACCAAGTTGG + Intronic
1001977032 5:176008563-176008585 GAGACCAGGTTTCACCATGTTGG + Intronic
1002240395 5:177835217-177835239 GAGACCAGGTTTCACCATGTTGG - Intergenic
1002328439 5:178425234-178425256 GAGACCGGGTTTCCCCATGTTGG - Intronic
1002490648 5:179574206-179574228 GAGACCAGGTTTCACCATGTTGG - Intronic
1003055271 6:2812539-2812561 GAGACAAGGTTTCCCCACGTTGG - Intergenic
1003866925 6:10371830-10371852 GAGACCAGGTTTCACCATGTTGG - Intergenic
1004571867 6:16853889-16853911 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1004679160 6:17875639-17875661 GAGACGAGGTCTCACCATGTTGG + Intronic
1004840979 6:19584890-19584912 GAGACCGGGTTTCACCAAGTTGG - Intergenic
1005049413 6:21670145-21670167 GAGACCGGGTTTCCCCATGTTGG + Intergenic
1005049539 6:21672168-21672190 GAGACCAGGTTTCTCCATGTTGG + Intergenic
1005292543 6:24393843-24393865 GAGACAAGGTTTCCCCATGTTGG + Intergenic
1005635009 6:27744879-27744901 GAGACCGGGTTACTCCATGTTGG + Intergenic
1006086434 6:31598949-31598971 GAGAAGAGGTCACCACCAGTGGG + Intergenic
1006117581 6:31783316-31783338 GAGACTAGGTTTCCCCATGTTGG - Intronic
1006180234 6:32149961-32149983 GAGGCCAGGACAGCCCCAGTGGG - Intronic
1006407549 6:33854048-33854070 GAGACGAGGTTTCACCAAGTTGG - Intergenic
1006471190 6:34229776-34229798 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1006494695 6:34413933-34413955 GAGACCAGGTTTCTCCATGTTGG + Intronic
1006531457 6:34658618-34658640 GAGACAAGGTTTCCCCATGTTGG - Intronic
1007021034 6:38521859-38521881 GAGACCAGGTTTCACCATGTTGG + Intronic
1008454597 6:51694579-51694601 GAGACCAGGTTTCACCATGTCGG + Intronic
1008510515 6:52271454-52271476 GAGACCAGGTTTCTCCATGTTGG - Intronic
1008526452 6:52412361-52412383 GAGACCAGGTTTCTCCATGTTGG + Intergenic
1008907546 6:56696346-56696368 GAGACCAGGTTTCTCCATGTTGG + Intronic
1009305843 6:62088686-62088708 GGGTCCATGTCCCCCCAAGTGGG - Intronic
1009390380 6:63137177-63137199 GAGACCAGCTCACTCACAGTTGG + Intergenic
1009526037 6:64747564-64747586 GAGACCAGGTTTCACCATGTTGG + Intronic
1009949728 6:70381466-70381488 GAGACCAGGTTTCACCATGTTGG - Intergenic
1010153764 6:72767784-72767806 GATACCACTTCACCCCAATTAGG + Intronic
1010963707 6:82177734-82177756 GAGACAAGGTTTCCCCATGTTGG + Intronic
1012250697 6:96976783-96976805 GAGACGGGGTCTCACCAAGTTGG + Intronic
1012461253 6:99463623-99463645 GAGACCAGGTTTCACCATGTTGG - Intronic
1012588873 6:100954914-100954936 GAGACCAGGTTTCACCATGTTGG - Intergenic
1012875509 6:104721156-104721178 GAGACCAGGTGTCACCATGTTGG - Intergenic
1012889175 6:104879610-104879632 GAGACAAGGTTTCCCCATGTTGG + Intergenic
1013121469 6:107145062-107145084 GAGACCAGGTTTCACCATGTTGG + Intergenic
1013250728 6:108330360-108330382 GAGACCAGGTTTCACCATGTTGG + Intronic
1014205008 6:118648065-118648087 GAGACAAGGTCTCACCATGTTGG - Intronic
1014270697 6:119332628-119332650 GAGACCAGGTTTCACCATGTTGG - Intronic
1014410797 6:121117513-121117535 GAGACCAGGTTTCACCATGTTGG - Intronic
1014723155 6:124943247-124943269 GAGACCAGGTTTCACCATGTTGG + Intergenic
1015114854 6:129636688-129636710 GAGACAAGGTCTCGCCATGTTGG - Intronic
1015276334 6:131386605-131386627 GAGACGAGGTTTCCCCATGTTGG - Intergenic
1015962143 6:138660903-138660925 GAGACCAGGTTTCACCATGTTGG - Intronic
1016253032 6:142070422-142070444 GAGACCAGGTTTCACCATGTTGG + Intronic
1016384677 6:143518921-143518943 GAGACGAGGTTACGCCATGTTGG + Intergenic
1016830171 6:148426020-148426042 GAGACCAGGTTTCACCATGTTGG - Intronic
1016958862 6:149652761-149652783 GAGACAAGGTCTCACCATGTTGG + Intergenic
1017148272 6:151254535-151254557 GAGACCGGGTTTCGCCAAGTTGG + Intronic
1017663520 6:156696438-156696460 GAGACCAGGTTTCACCACGTTGG + Intergenic
1017826785 6:158087385-158087407 GTGACCAGGTCACCTCCAGGCGG - Intronic
1018157054 6:160994885-160994907 GAGACAAGGTTTCACCAAGTTGG + Intronic
1018274672 6:162117908-162117930 GAGACAAGGTTTCCCCACGTTGG - Intronic
1018290136 6:162284408-162284430 GAGACCAGGTTTCTCCATGTTGG + Intronic
1018447399 6:163870170-163870192 GAAACCAGGTGTCCCCAGGTTGG + Intergenic
1018567361 6:165168797-165168819 GAGACCAGGTTTCTCCATGTTGG - Intergenic
1019718362 7:2553215-2553237 GAGACGAGGTCTCACCATGTTGG + Intronic
1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG + Intronic
1020008746 7:4796831-4796853 GAGACCAGGTTTCACCATGTTGG - Intergenic
1020191785 7:6005521-6005543 GAGACAAGGTCTCACCATGTTGG + Intronic
1020241383 7:6397799-6397821 GAGACCAGGTTTCACCATGTTGG - Intronic
1020585527 7:10061018-10061040 GAGACGAGGTTTCACCAAGTTGG + Intergenic
1021300582 7:18967974-18967996 GAGACCGGGTTTCTCCAAGTTGG - Intronic
1021404625 7:20250569-20250591 GAGACCAGGTTTCACCATGTTGG - Intergenic
1021435333 7:20606976-20606998 GATACCAGGTTTCGCCAAGTTGG + Intergenic
1021714710 7:23451229-23451251 GAGACCAGGTTTCACCATGTTGG - Intronic
1021835031 7:24662580-24662602 GAGACCAGGTTTCACCATGTTGG - Intronic
1022044292 7:26610963-26610985 GAGACCAGGTAACGCCAGGAGGG - Intergenic
1022336415 7:29426020-29426042 GAGACCAGGTTTCACCATGTTGG - Intronic
1023001871 7:35816764-35816786 GATACCAGCTCACACCCAGTAGG - Intronic
1023020702 7:36009430-36009452 GAGACGAGGTTTCTCCAAGTTGG + Intergenic
1023549977 7:41358869-41358891 GAGACCAGGTTTCACCATGTTGG - Intergenic
1023891313 7:44393881-44393903 GACACCACGTCCCCCCAAGAGGG + Intronic
1024260362 7:47569665-47569687 GAGACGAGGTTTCCCCATGTTGG - Intronic
1024988665 7:55218131-55218153 GAGACCAGGACGGCCCATGTAGG + Intronic
1025160991 7:56660601-56660623 GAGACCAGGTTTCACCATGTTGG - Intergenic
1025604994 7:63033314-63033336 GAGACCAGGTTTCACCATGTTGG - Intergenic
1025662486 7:63564343-63564365 GAGACCAGGTTTCACCATGTTGG + Intergenic
1025829482 7:65037585-65037607 GAGACGAGGTTACACCATGTAGG + Intergenic
1025957193 7:66192069-66192091 GAGACCAGGTTTCACCATGTTGG - Intergenic
1026009246 7:66624067-66624089 GAGACCAGGTTTCACCATGTTGG + Intergenic
1026051900 7:66953790-66953812 GAGACCGGGTCTCACCATGTTGG + Intronic
1026263767 7:68778379-68778401 GAGACCAGGTCTCACCATGTTGG - Intergenic
1026272694 7:68850355-68850377 GAGACGAGGTTTCACCAAGTTGG + Intergenic
1026314521 7:69216628-69216650 GAGACAGGGTTTCCCCAAGTTGG + Intergenic
1026449099 7:70511760-70511782 GAGACCAGGTTTCACCACGTTGG + Intronic
1026682279 7:72476133-72476155 GAGACCAGGACTCACCATGTTGG + Intergenic
1026745677 7:73009940-73009962 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1026749331 7:73037882-73037904 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1026752979 7:73066027-73066049 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1026756629 7:73094153-73094175 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1027031783 7:74894614-74894636 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1027090776 7:75299275-75299297 GAGACGAGGTCTCCCCATGTTGG + Intergenic
1027094421 7:75327245-75327267 GAGACGAGGTCTCCCCATGTTGG + Intergenic
1027098064 7:75355170-75355192 GAGACGAGGTCTCCCCATGTTGG + Intergenic
1027122247 7:75530210-75530232 GAGACCAGGTTTCACCATGTTGG - Intergenic
1027324917 7:77040441-77040463 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1027511932 7:79093899-79093921 GAGACGAGGTTTCACCAAGTTGG + Intronic
1029214972 7:98941360-98941382 GAGACCAGGTCACACCATGTTGG + Intronic
1029349431 7:100002814-100002836 GAGACAAGGTCTCACCATGTTGG + Intergenic
1029382591 7:100223320-100223342 GAGACCAGGTTTCTCCATGTTGG + Intronic
1029399172 7:100332063-100332085 GAGACGAGGTCTCACCATGTTGG + Intergenic
1029559916 7:101295870-101295892 GAGACCAGGTTTCACCATGTTGG + Intergenic
1029655728 7:101923166-101923188 GAGACCAGGTAACCCAGCGTGGG + Intronic
1029664759 7:101988023-101988045 GAGACGAGGTTTCCCCATGTTGG - Intronic
1030049925 7:105528978-105529000 GAGACCAGGTTTCACCATGTTGG + Intergenic
1031982054 7:128134438-128134460 GAGACCAGGTTTCACCATGTTGG - Intergenic
1032163006 7:129525096-129525118 GAGACAAGGTTTCACCAAGTTGG + Intergenic
1032592079 7:133200770-133200792 GAGACCAGGTTTCACCATGTTGG + Intergenic
1033005111 7:137552720-137552742 GAGACCGGGTCTCGCCATGTTGG - Intronic
1033130929 7:138744887-138744909 GAGACCAGGTTTCACCATGTCGG + Intronic
1033873775 7:145789379-145789401 GAGACAAGGTCTCACCATGTTGG + Intergenic
1034009776 7:147517054-147517076 GAGACCAGGTTTCACCATGTTGG + Intronic
1034656945 7:152737149-152737171 GAGACCAGGTTTCACCATGTTGG + Intergenic
1034688589 7:152995845-152995867 GAGACCAGGTTTCACCATGTTGG + Intergenic
1034985811 7:155514706-155514728 GAGACCGGGTCTCTCCATGTTGG - Intronic
1035145430 7:156810995-156811017 GAGACGAGGTTTCACCAAGTTGG + Intronic
1035172916 7:157029781-157029803 GAGACCTGGACACCCTAGGTTGG + Intergenic
1035189918 7:157157786-157157808 GAGACCAGGTTTCACCACGTTGG - Intronic
1035969254 8:4228866-4228888 GAGACCGGCTTTCCCCAAGTTGG + Intronic
1036188402 8:6646236-6646258 GAGACAAGGTTTCACCAAGTTGG - Intergenic
1036426984 8:8654102-8654124 GAGACCAGGTTTCACCATGTTGG + Intergenic
1037132173 8:15420308-15420330 GAGACGAGGTTTCCCCATGTTGG - Intronic
1037257095 8:16967023-16967045 GAGACAAGGTTTCACCAAGTTGG - Intergenic
1037286259 8:17303794-17303816 GAGACTGGGTCTCCCCATGTTGG + Intronic
1038784816 8:30602568-30602590 GAGACCAGGTTTCTCCATGTTGG - Intronic
1039106450 8:33995081-33995103 GAGACCAGGTTTCACCATGTTGG - Intergenic
1039194051 8:35010449-35010471 GAGACGAGGTCTCACCATGTTGG - Intergenic
1039294453 8:36134375-36134397 GAGACCAGGTTTCACCATGTTGG + Intergenic
1039752325 8:40489957-40489979 GAGACCAGGTTTCACCATGTTGG + Intergenic
1039940747 8:42088567-42088589 GAGACCAGGTTTCACCATGTTGG + Intergenic
1039975836 8:42364111-42364133 GAGACCAGGTTTCACCATGTTGG + Intronic
1041268240 8:56085454-56085476 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1041779727 8:61564483-61564505 GAGACCAGGTTTCACCATGTTGG + Intronic
1042307810 8:67349690-67349712 GAGACCAGGTGTCACCATGTTGG - Intergenic
1042347998 8:67747308-67747330 GAGACGAGGTTTCCCCATGTCGG + Intergenic
1042432583 8:68726093-68726115 GAGACCAGGTTTCACCATGTTGG + Intronic
1042449741 8:68930577-68930599 GAGACCAGATCTCACCATGTTGG - Intergenic
1042925286 8:73961697-73961719 GAGACCAGGTTTCGCCATGTTGG + Intronic
1043145663 8:76650614-76650636 GAGACCAGGTTTCACCATGTTGG + Intergenic
1043160336 8:76838866-76838888 GAGACGAGGTCTCCTCATGTTGG - Intronic
1044118110 8:88359415-88359437 GACACCACTTCACACCAAGTAGG - Intergenic
1044302551 8:90602974-90602996 GAGACCGGGTCTCACCATGTTGG + Intergenic
1044583831 8:93850375-93850397 GAGACCAGGTTTCACCATGTTGG - Intergenic
1044651427 8:94499856-94499878 GAGACCGGGTTACCCTATGTTGG - Intronic
1045027197 8:98098938-98098960 GAGACGGGGTCTCACCAAGTTGG + Intergenic
1046022166 8:108678557-108678579 GAGACAAGGTCTCGCCATGTTGG + Intronic
1046981121 8:120337202-120337224 GAGACCAGGTTTCACCATGTTGG - Intronic
1047016844 8:120732656-120732678 GAGACGAGGTTTCCCCATGTTGG - Intronic
1047288299 8:123506973-123506995 GACATCAGGTCCCTCCAAGTAGG + Intronic
1047632067 8:126718745-126718767 GAGACAAGGTTTCACCAAGTTGG - Intergenic
1047734361 8:127752519-127752541 GAGACGAGGTCTCACCATGTTGG - Intergenic
1047812209 8:128423159-128423181 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1049077111 8:140407206-140407228 CAGAGCTGGTGACCCCAAGTAGG + Intronic
1049311671 8:141936876-141936898 GAGCCCAGGTCACCCCGAATGGG - Intergenic
1049869452 8:144962439-144962461 GAGACCAGGTTTCACCATGTTGG + Intergenic
1050638845 9:7643337-7643359 GAGACAAGGTTTCCCCATGTTGG + Intergenic
1051772734 9:20596501-20596523 GAGACAAGGTCTCACCATGTTGG - Intronic
1052769417 9:32673766-32673788 GAGACCAGGTTTCACCATGTTGG - Intergenic
1052810249 9:33051866-33051888 GAGACGGGGTCACTCCAAGTTGG - Intronic
1052851676 9:33381899-33381921 GAGACCAGGTTTCGCCATGTTGG - Intergenic
1052945491 9:34165091-34165113 GAGACGAGGTTTCCCCATGTTGG + Intergenic
1053068012 9:35082074-35082096 GAGACGAGGTTTCACCAAGTTGG - Intergenic
1053321327 9:37101419-37101441 GAGTCCAGGCCATCCCAAGGAGG - Intergenic
1053368616 9:37542013-37542035 GAGACCAGGTTTCTCCATGTTGG + Intronic
1053394083 9:37756517-37756539 GAGATCAGGTTTCACCAAGTTGG - Intronic
1055025742 9:71718761-71718783 GAGACAAGGTCTCCCCATGTTGG + Intronic
1055286459 9:74733742-74733764 GAGACCAGGTTTCTCCATGTTGG + Intronic
1056352744 9:85767666-85767688 GAGACGAGGTCTCGCCATGTTGG + Intergenic
1056503784 9:87236974-87236996 GAGACCGGGTCTCACCATGTTGG - Intergenic
1056514713 9:87339467-87339489 GAGACCAGGTTTCACCATGTTGG + Intergenic
1057111023 9:92471381-92471403 GAGACGAGGTTTCCCCATGTTGG + Intronic
1057144942 9:92751989-92752011 GAGACGAGGTTTCCCCATGTTGG + Intronic
1057267381 9:93627919-93627941 GAGGACAGATCTCCCCAAGTGGG - Intronic
1057585342 9:96323736-96323758 GAGACCAGGTTTCACCATGTTGG - Intronic
1057924824 9:99136039-99136061 GAGACCAGGTTTCACCATGTTGG + Intronic
1058663498 9:107287646-107287668 GAGACCAGGTTTCACCATGTTGG - Intronic
1058856033 9:109063304-109063326 GAGACCAGGTTTCACCATGTTGG + Intronic
1058987016 9:110218079-110218101 GAGACCAGGTTTCACCATGTTGG + Intergenic
1059288887 9:113203711-113203733 GAGACCAGGTTTCACCATGTTGG + Intronic
1059876469 9:118640971-118640993 GAATCCAGCTCTCCCCAAGTTGG - Intergenic
1059978094 9:119739240-119739262 GAGACCAGGTGTCACCATGTTGG + Intergenic
1060132628 9:121119480-121119502 GAGACAAGGTCTCACCATGTTGG + Intronic
1060470170 9:123942084-123942106 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1061018522 9:127997932-127997954 GAGACCAGGTTTCACCATGTTGG + Intergenic
1061020672 9:128012403-128012425 GAGACCAGGTTTCCTCATGTTGG - Intergenic
1061023191 9:128030194-128030216 GAGACGAGGTTTCCCCACGTTGG - Intergenic
1061319551 9:129819567-129819589 GAGACCAGGTTTCACCATGTTGG - Intronic
1061345535 9:130022043-130022065 GAGACAAGGTCTCACCATGTTGG + Intronic
1061422853 9:130481511-130481533 GAGAGCCGATCACCCCATGTGGG + Intronic
1061743900 9:132726007-132726029 GTGGCCAGGACACCCCAAATTGG - Intronic
1062754406 9:138279599-138279621 GAGGCCAGGCCTCCTCAAGTTGG + Intergenic
1203578310 Un_KI270745v1:23759-23781 GAGGCCAGGCCTCCTCAAGTTGG + Intergenic
1185484674 X:473413-473435 GAGACCGGGTTTCCCCATGTTGG + Intergenic
1185509733 X:654872-654894 GAGACGAGGTTTCCCCATGTTGG + Intronic
1185527013 X:788262-788284 GAGACCAGGTTTCACCATGTTGG + Intergenic
1185574130 X:1156670-1156692 GAGACCAGGTTTCACCATGTTGG - Intergenic
1185583718 X:1229788-1229810 GAGACGAGGTTTCCCCATGTCGG + Intergenic
1185772539 X:2775767-2775789 GAGACCAGGTTTCACCATGTTGG - Intronic
1186154700 X:6712859-6712881 GAGACAGGGTCACACCATGTTGG - Intergenic
1186743910 X:12546362-12546384 GAGACCAGGTTTCACCAGGTTGG + Intronic
1187350725 X:18514518-18514540 GAGACCAGGTTTCACCACGTTGG - Intronic
1187444892 X:19352420-19352442 GAGACCAGGTTTCACCATGTTGG + Intronic
1187567827 X:20469866-20469888 GAGACCAGGTTTCGCCATGTGGG - Intergenic
1187913509 X:24132096-24132118 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1187914394 X:24139899-24139921 GAGACCAGGTTTCACCATGTTGG + Intergenic
1187968495 X:24636424-24636446 GAGACCAGGTTTCACCATGTTGG - Intronic
1187986156 X:24813625-24813647 GAGACGGGGTTTCCCCAAGTTGG - Intronic
1188313415 X:28645159-28645181 GAGACAGGGTCACTCCATGTAGG - Intronic
1188352939 X:29154351-29154373 GAGACCAGGTTTCACCATGTTGG - Intronic
1188494300 X:30767190-30767212 GAGACCAGGTTTCACCATGTTGG + Intergenic
1189282470 X:39828453-39828475 GAGACCAGGTTTCACCATGTTGG - Intergenic
1189442485 X:41049660-41049682 GAGACCAGGTTTCGCCATGTTGG - Intergenic
1189883862 X:45519740-45519762 GAGACCAGGTTTCACCATGTTGG + Intergenic
1190074173 X:47303548-47303570 GAGACAGGGTCTCCCCACGTTGG + Intergenic
1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG + Intergenic
1190699506 X:52976255-52976277 GAGACCAGGTTTCACCATGTTGG - Intronic
1190853107 X:54265855-54265877 GAGACCAGGTTTCACCATGTTGG - Intronic
1192872763 X:75200405-75200427 GAGACCAGGTTTCACCATGTTGG - Intergenic
1193128200 X:77892079-77892101 GAGACGGGGTTTCCCCAAGTTGG + Intronic
1193993457 X:88337984-88338006 GAGACAGGGTTTCCCCAAGTTGG + Intergenic
1194103135 X:89733114-89733136 GAGACCAGGTTTCACCATGTTGG + Intergenic
1194421902 X:93685920-93685942 GAGACCAGGTTTCACCATGTTGG - Intronic
1195036819 X:100977565-100977587 GAGACGAGGTCTCACCATGTTGG + Intronic
1195066192 X:101240420-101240442 GAGACCAGGTCTCGCCATGTTGG + Intronic
1195645014 X:107221159-107221181 GAGACGAGGTTTCACCAAGTTGG + Intronic
1195751040 X:108162161-108162183 GAGACAAGGTTTCCCCATGTTGG - Intronic
1196837642 X:119828249-119828271 GAGACCAGGTTTCACCACGTTGG + Intergenic
1197520524 X:127491178-127491200 GATACCAGGTCAGCCACAGTAGG - Intergenic
1198376870 X:136049286-136049308 GAGACCAGGTTTCACCATGTTGG - Intergenic
1199159969 X:144597309-144597331 GATACCAGCTCAGCCAAAGTAGG - Intergenic
1199386086 X:147225027-147225049 GAGACCAGGTTTCACCACGTTGG - Intergenic
1200022600 X:153224836-153224858 GAGACCAGGTTTCTCCATGTTGG + Intergenic
1200392795 X:155960980-155961002 GAGACCAGGTTTCACCATGTTGG + Intergenic
1200792442 Y:7311884-7311906 GAGACCAGGTTTCACCATGTTGG + Intergenic
1202045327 Y:20731660-20731682 GAGACAAGGTTTCCCCAAGTTGG + Intergenic
1202093130 Y:21214885-21214907 GAGACAAGGTTTCCCCATGTTGG - Intergenic
1202116560 Y:21474151-21474173 GGGCCCATGTTACCCCAAGTTGG + Intergenic