ID: 1089555904

View in Genome Browser
Species Human (GRCh38)
Location 11:119315936-119315958
Sequence GTCACTCGACACCATCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089555902_1089555904 -6 Left 1089555902 11:119315919-119315941 CCCTGTGAGGAGGTGATGTCACT 0: 1
1: 1
2: 1
3: 18
4: 159
Right 1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
1089555903_1089555904 -7 Left 1089555903 11:119315920-119315942 CCTGTGAGGAGGTGATGTCACTC 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
1089555898_1089555904 9 Left 1089555898 11:119315904-119315926 CCAGCGTGCTGCCAGCCCTGTGA 0: 1
1: 0
2: 2
3: 29
4: 218
Right 1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
1089555901_1089555904 -2 Left 1089555901 11:119315915-119315937 CCAGCCCTGTGAGGAGGTGATGT 0: 1
1: 0
2: 0
3: 12
4: 217
Right 1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089555904 Original CRISPR GTCACTCGACACCATCTGCC TGG Intronic
901763361 1:11484850-11484872 GTCCCTGGACACTATCTCCCAGG - Intronic
903835734 1:26202290-26202312 GCCCCTCCACACCATCAGCCTGG + Intronic
903889372 1:26559177-26559199 GTCACTCGGCACCACCACCCTGG - Intronic
905117155 1:35652174-35652196 GTCACTTGACATCTTCTGACTGG + Intergenic
913288999 1:117254814-117254836 GTCACTGGAGCCAATCTGCCTGG + Intergenic
923976259 1:239267212-239267234 GTCACTGTGCACCATCTGCTTGG - Intergenic
1063428812 10:5970611-5970633 GTAACTGGCCACCATTTGCCTGG - Intronic
1069544663 10:69319453-69319475 GGCACCCGACACCCTCCGCCAGG - Intronic
1069902875 10:71715988-71716010 GTCCCTCGACAGCCCCTGCCGGG - Exonic
1072799135 10:98380680-98380702 GTCTCTGGACACCATCACCCAGG + Intergenic
1084003562 11:66311979-66312001 GCCCATCGACGCCATCTGCCCGG + Intergenic
1084190742 11:67497613-67497635 GGCCTTCCACACCATCTGCCAGG + Exonic
1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG + Intronic
1090548654 11:127793907-127793929 GTCACTCTACACCAGCTCCTCGG - Intergenic
1090889219 11:130908069-130908091 GGCACTCACCACCATCTGCAGGG + Exonic
1091777371 12:3193326-3193348 GACAATCCACACCACCTGCCTGG + Intronic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1104366937 12:128186559-128186581 GTCTCTCCACACAATCTGGCTGG - Intergenic
1110835508 13:80077639-80077661 CTCACTCCACCCCATCTTCCCGG - Intergenic
1112065114 13:95784547-95784569 GTCACTAGACACGTTCTGTCTGG + Intronic
1122864430 14:104597154-104597176 CTCACTGGACACCACCTCCCAGG + Intronic
1131853301 15:96565459-96565481 TTGACTCATCACCATCTGCCTGG + Intergenic
1131958901 15:97767289-97767311 GTCACTCTACCACAACTGCCTGG - Intergenic
1132560986 16:593883-593905 GTAACTCGCCACCATCACCCAGG - Intronic
1133384089 16:5354835-5354857 GCCACTTGTCACCATGTGCCAGG + Intergenic
1133872217 16:9699714-9699736 TGCACTCGAGACCATCTGGCAGG - Intergenic
1135787742 16:25365619-25365641 TTCCCTTAACACCATCTGCCTGG + Intergenic
1138588960 16:57989055-57989077 GTCACTTGATGCCATCTGGCAGG - Intergenic
1140112610 16:72016700-72016722 CTCACTTGCCACCTTCTGCCTGG - Intronic
1140637329 16:76930530-76930552 GCTACTCAACACAATCTGCCAGG - Intergenic
1141439798 16:84022732-84022754 GTCACTCCCCACCCTCTGCAGGG + Intronic
1142119190 16:88377547-88377569 GTCACGCGCCACCATCCGTCTGG + Intergenic
1142252813 16:89000491-89000513 GTCACTAGACTCCATCTTTCCGG + Intergenic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1144591634 17:16529025-16529047 CTCACTCTCCACCATCTCCCAGG + Intergenic
1149597719 17:57874087-57874109 GTCACTCAGCACCATGAGCCTGG - Intronic
1153517656 18:5919181-5919203 ATCACTCCACACCATTTTCCAGG - Intergenic
1155249304 18:23940048-23940070 GTGACTCCAGACCATGTGCCAGG + Intronic
1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG + Exonic
1160700025 19:501742-501764 GTCTCCCGACACCACCTCCCAGG + Exonic
1160912824 19:1482726-1482748 GTCATTGCACACCATCTCCCGGG + Intronic
925739711 2:6994973-6994995 GTCACTGGGCCCCATCTGCTGGG + Intronic
926518866 2:13884182-13884204 GTCTCTAGTCACCATGTGCCTGG + Intergenic
927894522 2:26772934-26772956 ATCAGTCATCACCATCTGCCGGG + Intronic
927916847 2:26942615-26942637 GCCACTGGTCACCATCAGCCGGG + Exonic
936058380 2:109278618-109278640 GTCACTTGTGAACATCTGCCTGG + Intronic
945437917 2:209840573-209840595 GGTCCTCCACACCATCTGCCAGG - Exonic
1171437083 20:25132117-25132139 GACACTAGTCACCATCTTCCTGG - Intergenic
1175500734 20:59448808-59448830 GTCACTTGCCACCCTGTGCCTGG - Intergenic
1179002644 21:37477557-37477579 GGCTCTCGACACCATCTGACAGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1185325287 22:50222629-50222651 GTCACCCCACCCCATCTACCTGG + Intronic
954272629 3:49521653-49521675 GGCACTAAACACCATCAGCCTGG - Intronic
957364730 3:79208247-79208269 CTCACTTGACACCAAATGCCTGG + Intronic
959019411 3:101171938-101171960 GTCACTAGTAACCATCTGCTTGG + Intergenic
960273441 3:115699456-115699478 GTGTCTAGACACCAGCTGCCTGG - Intronic
968061311 3:195728044-195728066 GTAACACGACCCCATCTGACAGG + Intronic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
970309522 4:14767512-14767534 GTCCCTAGACACCAAATGCCTGG - Intergenic
981542202 4:145857703-145857725 GCCACCCGACATCATCTGCTGGG - Intronic
985539862 5:482892-482914 GTCCCTCGTCACCATCCACCCGG + Intronic
986556408 5:9014512-9014534 CTCACCAGACACCATCTGCCAGG - Intergenic
989156741 5:38351567-38351589 TTCACACTACTCCATCTGCCTGG - Intronic
998168768 5:139859849-139859871 GTCACTCAGCACCATCTGCGTGG - Intronic
999151991 5:149432474-149432496 GTGACTGGTCACGATCTGCCAGG + Intergenic
1000283040 5:159798818-159798840 CTCACCCCACCCCATCTGCCTGG + Intergenic
1004310902 6:14544069-14544091 GCCATTCTGCACCATCTGCCTGG + Intergenic
1013152386 6:107459183-107459205 GTCCCTCGACACCATCTCCTCGG - Exonic
1014653826 6:124074240-124074262 GTCACCCGACACCTTCTGCCTGG + Intronic
1017295006 6:152783331-152783353 GTGACAGGCCACCATCTGCCTGG + Intergenic
1024231964 7:47369443-47369465 GCCACTCTACAGCCTCTGCCAGG - Exonic
1028547155 7:92014916-92014938 CTCACTCTACACCGTCTCCCAGG - Intronic
1035941403 8:3905412-3905434 GTGACTTGACGCCACCTGCCTGG - Intronic
1036145477 8:6251000-6251022 GTCAGTCTACTCCATCTGCTTGG + Intergenic
1036224324 8:6945137-6945159 GAGCCTCGACACCATCAGCCTGG + Intergenic
1037178051 8:15970552-15970574 GTCCATCGCCATCATCTGCCAGG - Intergenic
1039957499 8:42218450-42218472 CACACCCGAGACCATCTGCCGGG + Intergenic
1043417019 8:80061538-80061560 GGCGCTTGCCACCATCTGCCTGG - Intronic
1055044475 9:71910662-71910684 CTCTCTCGACCCCTTCTGCCCGG - Exonic
1056366380 9:85909137-85909159 GGCACACGCCACCATATGCCTGG - Intergenic
1056992726 9:91425516-91425538 GTTCCCCGACACCATCTTCCCGG + Intergenic
1058123088 9:101160379-101160401 GGCACTTTACATCATCTGCCAGG - Intronic
1059460231 9:114424903-114424925 GTCACTCGGCACCCTCTGGCTGG + Intronic
1185861489 X:3583494-3583516 GTCACTTGACTCCCTCTTCCTGG - Intergenic
1186943567 X:14540026-14540048 GTGACTAGTCACCATGTGCCAGG + Intronic
1187702412 X:21975545-21975567 CTCACTCCCCACCATCAGCCAGG + Intronic
1196691213 X:118560838-118560860 GGCACTCGACAACAACTGGCAGG + Intronic