ID: 1089559672

View in Genome Browser
Species Human (GRCh38)
Location 11:119337585-119337607
Sequence CAAATTAAGCCCTTGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089559667_1089559672 30 Left 1089559667 11:119337532-119337554 CCCTCTCGCAACACATGGCTTTC No data
Right 1089559672 11:119337585-119337607 CAAATTAAGCCCTTGTAGAGAGG No data
1089559669_1089559672 1 Left 1089559669 11:119337561-119337583 CCTTCTATTTTTTCTGTTTTTTC No data
Right 1089559672 11:119337585-119337607 CAAATTAAGCCCTTGTAGAGAGG No data
1089559668_1089559672 29 Left 1089559668 11:119337533-119337555 CCTCTCGCAACACATGGCTTTCG No data
Right 1089559672 11:119337585-119337607 CAAATTAAGCCCTTGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089559672 Original CRISPR CAAATTAAGCCCTTGTAGAG AGG Intergenic
No off target data available for this crispr