ID: 1089559888

View in Genome Browser
Species Human (GRCh38)
Location 11:119338472-119338494
Sequence TTTCTGAGATGACCACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089559888_1089559892 1 Left 1089559888 11:119338472-119338494 CCCCCTTGTGGTCATCTCAGAAA No data
Right 1089559892 11:119338496-119338518 TGCTTATCTTTAGACGCCCGAGG No data
1089559888_1089559895 17 Left 1089559888 11:119338472-119338494 CCCCCTTGTGGTCATCTCAGAAA No data
Right 1089559895 11:119338512-119338534 CCCGAGGACGCCACTCACTCGGG No data
1089559888_1089559893 16 Left 1089559888 11:119338472-119338494 CCCCCTTGTGGTCATCTCAGAAA No data
Right 1089559893 11:119338511-119338533 GCCCGAGGACGCCACTCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089559888 Original CRISPR TTTCTGAGATGACCACAAGG GGG (reversed) Intergenic
No off target data available for this crispr