ID: 1089560095

View in Genome Browser
Species Human (GRCh38)
Location 11:119339504-119339526
Sequence TGGGCCACCCCCCGAAAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089560082_1089560095 12 Left 1089560082 11:119339469-119339491 CCTCACCATGGCCCCCCCCGAGA 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560092_1089560095 -4 Left 1089560092 11:119339485-119339507 CCCGAGAGCGAGGCTGGCTTGGG 0: 1
1: 0
2: 5
3: 23
4: 260
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560094_1089560095 -5 Left 1089560094 11:119339486-119339508 CCGAGAGCGAGGCTGGCTTGGGC 0: 1
1: 0
2: 0
3: 28
4: 203
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560089_1089560095 -2 Left 1089560089 11:119339483-119339505 CCCCCGAGAGCGAGGCTGGCTTG 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560079_1089560095 25 Left 1089560079 11:119339456-119339478 CCTCAGGCTCCAGCCTCACCATG 0: 1
1: 0
2: 5
3: 50
4: 467
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560081_1089560095 16 Left 1089560081 11:119339465-119339487 CCAGCCTCACCATGGCCCCCCCC 0: 1
1: 0
2: 1
3: 61
4: 677
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560083_1089560095 7 Left 1089560083 11:119339474-119339496 CCATGGCCCCCCCCGAGAGCGAG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560090_1089560095 -3 Left 1089560090 11:119339484-119339506 CCCCGAGAGCGAGGCTGGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560087_1089560095 0 Left 1089560087 11:119339481-119339503 CCCCCCCGAGAGCGAGGCTGGCT 0: 1
1: 0
2: 0
3: 8
4: 239
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560088_1089560095 -1 Left 1089560088 11:119339482-119339504 CCCCCCGAGAGCGAGGCTGGCTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1089560086_1089560095 1 Left 1089560086 11:119339480-119339502 CCCCCCCCGAGAGCGAGGCTGGC 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG 0: 1
1: 0
2: 0
3: 8
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089560095 Original CRISPR TGGGCCACCCCCCGAAAAAC TGG Exonic
901057585 1:6455873-6455895 TGAGCCGGCCCCCGAAGAACAGG + Intronic
901463372 1:9404894-9404916 TGGGCCACCCTCCCAAATGCTGG + Intergenic
902476775 1:16692605-16692627 TGGGCCGGCCCCCGAAGAACAGG - Intergenic
905920856 1:41717751-41717773 TGGGCGACCCCTGGATAAACAGG - Intronic
909035251 1:70589255-70589277 TGGCCCTCCCCCAGAAAAGCGGG - Intergenic
915245571 1:154553844-154553866 TGGGCCACACCCCCAACATCTGG - Intronic
923408829 1:233688241-233688263 TGCCCCTCCCCCAGAAAAACAGG + Intergenic
1064183619 10:13141324-13141346 TGGGAAGCCCCCTGAAAAACTGG + Intergenic
1066990285 10:42506555-42506577 CAGGCCACCCCCCCAAAATCTGG - Intergenic
1067223119 10:44358147-44358169 TGGGCAACACCGAGAAAAACGGG + Intergenic
1067317486 10:45181646-45181668 TAGGCCAGCCTCCAAAAAACCGG - Intergenic
1075802375 10:125161059-125161081 TGCCCCCCCCCCCCAAAAACAGG - Intronic
1077590071 11:3484356-3484378 TGTGCCTCCCCCAGAAAAGCAGG + Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1084245789 11:67856128-67856150 TGTGCCTCCCCCAGAAAAGCAGG + Intergenic
1084575408 11:69985561-69985583 TGAGCCAGCCCCCGAGAGACGGG - Intergenic
1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG + Exonic
1090480342 11:127062110-127062132 CTGGCCATCCCCCCAAAAACAGG - Intergenic
1090584992 11:128201892-128201914 TTGGCCACACCCTCAAAAACAGG - Intergenic
1092416374 12:8293258-8293280 TGGGCCTCCCTCAGAAAAGCGGG + Intergenic
1093172856 12:15878688-15878710 TGCCCCTCCCCCCCAAAAACTGG + Intronic
1111158003 13:84353691-84353713 TTCGCCACCCCCTTAAAAACAGG + Intergenic
1117278036 14:54209225-54209247 TGGGCCACCCCCACAAAGTCGGG + Intergenic
1119117667 14:72041520-72041542 TAGGCAGCCCCCTGAAAAACTGG + Intronic
1120385564 14:83841262-83841284 TGAGCCCCCCCCCCAAAAGCAGG + Intergenic
1129503389 15:76060507-76060529 TGGGGCACCTCCCGACAAACGGG - Intronic
1132703179 16:1230592-1230614 TGGGCCACCCTCCAAGAGACGGG + Intergenic
1132708269 16:1255639-1255661 TGGGCCACCCTCCAAGAGACGGG - Intergenic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1135743817 16:24998720-24998742 TGGGCCACGCCCCGAATCCCAGG + Intronic
1135752545 16:25068582-25068604 TGGGCCACGCCCCGAATCCCAGG - Intergenic
1136385381 16:29922654-29922676 AGGGCCACTCCCAGTAAAACAGG - Intronic
1138153508 16:54681641-54681663 TGGACCACCCCCCTCAAAAAAGG + Intergenic
1138561542 16:57803488-57803510 TGGGCCATCCCCTGACAAGCAGG - Intronic
1141477187 16:84281787-84281809 TGGGGCATCCCCAGAAACACAGG + Intergenic
1144760421 17:17704019-17704041 TGGGCCACCCCCCGAGGAGCCGG - Intronic
1164777617 19:30865138-30865160 TGGGCCAACCCCTGAGATACTGG - Intergenic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1202710790 1_KI270714v1_random:18429-18451 TGGGCCGGCCCCCGAAGAACAGG - Intergenic
936157542 2:110058236-110058258 TGGGGCACACCCAGAAAGACTGG + Intergenic
936175748 2:110218791-110218813 TGGCCCTCCCCCAGAAAAGCAGG - Intergenic
936187150 2:110313208-110313230 TGGGGCACACCCAGAAAGACTGG - Intergenic
1172310431 20:33913733-33913755 TGGGCCACCTCCAGAAAAGGTGG + Intergenic
1173970753 20:47150471-47150493 TCCCCCACCCCCCGAAAGACAGG + Intronic
1176086260 20:63296866-63296888 TGGGCTGCCCCCCGGAAAGCTGG - Intronic
1177100400 21:16893073-16893095 TGCCCCTCCCCCAGAAAAACAGG - Intergenic
1182418769 22:30238452-30238474 TGGGTCACCCTCCAAAAAAGAGG - Intergenic
1184223265 22:43114168-43114190 TGTCCCACCCCCAGAAAAACAGG - Intronic
950014154 3:9744329-9744351 CGGGCCGGCCCCCCAAAAACCGG + Exonic
954624741 3:52016303-52016325 TGGGCCTCTCCCCGAGAAATCGG + Intergenic
957060095 3:75474786-75474808 TGCCCCTCCCCCAGAAAAACAGG + Intergenic
961002050 3:123380519-123380541 AGGGCCACCCTCCTAAAATCAGG + Intronic
961893912 3:130151857-130151879 TGTGCCTCCCCCAGAAAAGCGGG + Intergenic
967849255 3:194070328-194070350 TGGGGCACCCCCAGAAAATCAGG + Intergenic
976314272 4:83642770-83642792 TGGGCAAGCCTCTGAAAAACAGG - Intergenic
986476068 5:8134791-8134813 AGTGCCAGCCCCTGAAAAACTGG + Intergenic
1001512953 5:172336604-172336626 TGAGCATCCCCCCAAAAAACTGG + Exonic
1019799540 7:3077934-3077956 TGGGGCACCCCAGGAGAAACTGG - Intergenic
1020315806 7:6904644-6904666 TGTGCCTCCCCCAGAAAAGCGGG - Intergenic
1027228095 7:76257388-76257410 GGGGCCACCCCCCTAGAGACAGG + Intronic
1028733424 7:94179310-94179332 TGGGCCATCCCCCTCATAACTGG + Intergenic
1034999771 7:155603502-155603524 TGGGGCACCCCTAGATAAACAGG + Intergenic
1048764416 8:137829494-137829516 TGCCCCTCCCCCAGAAAAACAGG + Intergenic
1049013856 8:139906219-139906241 TGGGCCACCTCCCCAACAACAGG + Intronic
1059092014 9:111369733-111369755 TGGTCCCCCCCCCAAAAAAAAGG - Intronic
1193553567 X:82928423-82928445 TGGGCAACTCACGGAAAAACTGG + Intergenic
1195569152 X:106379931-106379953 TGGTCCACCCCCCACAAAACTGG + Intergenic
1195618274 X:106929872-106929894 AGGGCCATCCCTAGAAAAACTGG - Exonic