ID: 1089561533

View in Genome Browser
Species Human (GRCh38)
Location 11:119345739-119345761
Sequence GGGCAGATCTTCCGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089561533_1089561537 -9 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561537 11:119345753-119345775 GATCTGCCCCCAGTACTCACTGG 0: 1
1: 0
2: 2
3: 8
4: 122
1089561533_1089561540 -2 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561540 11:119345760-119345782 CCCCAGTACTCACTGGACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 231
1089561533_1089561545 3 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561545 11:119345765-119345787 GTACTCACTGGACTGTGGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 181
1089561533_1089561547 5 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561547 11:119345767-119345789 ACTCACTGGACTGTGGGGAGGGG 0: 1
1: 0
2: 4
3: 34
4: 335
1089561533_1089561546 4 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561546 11:119345766-119345788 TACTCACTGGACTGTGGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 214
1089561533_1089561542 -1 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561542 11:119345761-119345783 CCCAGTACTCACTGGACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 134
1089561533_1089561544 0 Left 1089561533 11:119345739-119345761 CCCTTCTCCCGGAAGATCTGCCC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1089561544 11:119345762-119345784 CCAGTACTCACTGGACTGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089561533 Original CRISPR GGGCAGATCTTCCGGGAGAA GGG (reversed) Intronic
901665891 1:10825964-10825986 GGGCAGATCTGCCTTGAGAAGGG + Intergenic
903062761 1:20681696-20681718 GGGCAGATGTGGCTGGAGAAAGG - Intronic
903588789 1:24438491-24438513 GGGCAGGTCTTCCCTGAGAAGGG - Intronic
903850208 1:26301312-26301334 GGACAGGCCTCCCGGGAGAAAGG + Intronic
904293912 1:29505577-29505599 GGGAACATCTTCAGGGAGAGAGG + Intergenic
905942455 1:41874939-41874961 AGGCAGATCTGGTGGGAGAAAGG - Intronic
912709949 1:111943067-111943089 GGGCAAACTGTCCGGGAGAAGGG + Intronic
915572126 1:156750528-156750550 GTGAAGATCTTCCGCCAGAACGG - Intronic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
917436225 1:175023920-175023942 GGCCAGATCTTCCTGGAAAGTGG + Intergenic
919772743 1:201173099-201173121 GTGCAGCTCTTGCTGGAGAAGGG + Intergenic
923211572 1:231808453-231808475 AGGCACATCTTCCAGGACAAGGG - Intronic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923526878 1:234779408-234779430 GGGCACATGTTCCCGGAGGATGG - Intergenic
924588555 1:245381193-245381215 GAACAGATCTTCTGTGAGAATGG + Intronic
1068382098 10:56268767-56268789 AGGCAGATCTTCAGCTAGAAGGG + Intergenic
1068876741 10:62005117-62005139 GCTCTGATCTTCAGGGAGAAGGG + Intronic
1070594795 10:77824957-77824979 GAGCAGAGATTCCGGGAGCAGGG - Intronic
1071280534 10:84098408-84098430 GGTCAGATGTTACTGGAGAACGG - Intergenic
1071415553 10:85437669-85437691 GGGCAGGTCTTCCAGGAAGAAGG - Intergenic
1073435218 10:103512216-103512238 AGGGAGAACTTCCAGGAGAAGGG + Intronic
1076389850 10:130090952-130090974 GGGCAGAGCATCTAGGAGAAGGG + Intergenic
1076727395 10:132419965-132419987 GGGCAACTCCTCCGGGAGCAGGG + Intergenic
1076727498 10:132420430-132420452 GGGCAGGGCCTCCGGGAGATGGG - Intergenic
1077906471 11:6538597-6538619 GGGCTGAACTGCAGGGAGAAGGG - Exonic
1082763082 11:57145420-57145442 AGGCAGATGTTCCAGGAGAGGGG - Intergenic
1084170658 11:67399364-67399386 GCACAGAGCTCCCGGGAGAAAGG + Intronic
1085516883 11:77116699-77116721 GGGCAGGGCTTCCTGGAGAGGGG - Intronic
1089561533 11:119345739-119345761 GGGCAGATCTTCCGGGAGAAGGG - Intronic
1090654822 11:128835038-128835060 GGGCTGTTCTCCAGGGAGAATGG + Intergenic
1091326165 11:134689829-134689851 GGGCAGAGCTCCTGGGAGGAAGG - Intergenic
1094585614 12:31774809-31774831 GGGCAGTTCTTTGGGAAGAAGGG + Intergenic
1095232947 12:39763639-39763661 GAGAAGCTCTTCTGGGAGAATGG + Intronic
1096080433 12:48829009-48829031 GGACAGATCCTCTGAGAGAAGGG - Intergenic
1106134620 13:26964888-26964910 GGGCAGGACTGACGGGAGAAGGG + Intergenic
1108576797 13:51797833-51797855 GGTGAGATCATCCGGGAGAGCGG - Exonic
1110479745 13:75960462-75960484 GGGATGATCCTCCTGGAGAAGGG - Intergenic
1112256133 13:97832928-97832950 GGGATGATCTTCCTGGAAAATGG - Intergenic
1112563336 13:100532594-100532616 GGGCAGAGCTGCAGGGAGAGGGG + Exonic
1113171883 13:107513692-107513714 TGGCAGGTCTTCCAGGAGAATGG + Intronic
1116493659 14:45535998-45536020 GGACAGAGCTTCCAGCAGAAGGG - Intergenic
1116781818 14:49244646-49244668 GGACAGATCACCTGGGAGAAGGG + Intergenic
1117497291 14:56318322-56318344 GGGCAAATCATCAGGGAAAAAGG + Intergenic
1121956645 14:98219532-98219554 GGGAATATCTTCAAGGAGAAGGG - Intergenic
1122157706 14:99760242-99760264 GGGCTGAGTTTCCGGGAGAAGGG - Intronic
1122771579 14:104100110-104100132 GAGCAGACCCTCCTGGAGAAAGG + Intronic
1123837607 15:24211991-24212013 TGGCAGATCTTCCTGGGGAATGG + Intergenic
1123846830 15:24311744-24311766 TGGCAGATCTTCCTGGGGAATGG + Intergenic
1123865834 15:24518802-24518824 TGGCAGATCTTCCTGGGGAATGG + Intergenic
1124397686 15:29318895-29318917 TGGTAGATGTTCCTGGAGAAAGG - Intronic
1124690264 15:31815891-31815913 GGACAGATGTTCTGGGAGAAAGG + Intronic
1127245072 15:57164208-57164230 GGCCAGTTCTTGAGGGAGAATGG - Intronic
1127369924 15:58330257-58330279 GGGCTGATGTTCCCAGAGAAAGG - Intronic
1127861345 15:62996804-62996826 GGTCAGAATTTCTGGGAGAATGG - Intergenic
1132854079 16:2037064-2037086 GGACGGATCTCCAGGGAGAAGGG - Intronic
1136397418 16:30000918-30000940 GGGCTTCTCTTCCTGGAGAAAGG - Exonic
1136587093 16:31193669-31193691 GGGGGGATCTTCCAGGAGAATGG + Exonic
1137676414 16:50305814-50305836 GGGTCCATCTTCCTGGAGAAGGG + Exonic
1141498728 16:84428958-84428980 GGGCATATATTCAGGGAAAAAGG - Intronic
1144676940 17:17167941-17167963 GAGCAGATCTTCCTTGATAATGG + Intronic
1146133077 17:30295023-30295045 GGGAAGCTCTTTGGGGAGAAAGG + Intergenic
1148875055 17:50682149-50682171 GCGCAGTTCTTCCGGGAGTGGGG - Intronic
1148945712 17:51260361-51260383 GGGCCAATCTTCCGGGTGTAGGG - Intergenic
1149353680 17:55817522-55817544 GGTCAGTTCTTCCGGTAGAATGG + Intronic
1152942414 17:83179742-83179764 GAGTAGCTCTTGCGGGAGAAAGG - Intergenic
1153830959 18:8922203-8922225 GGGAAGTTCTTCCAGAAGAAAGG - Intergenic
1156493847 18:37512903-37512925 CTGCAGAACTCCCGGGAGAAGGG - Intronic
1157112383 18:44833298-44833320 GGAAAGATCTTTCTGGAGAAAGG + Intronic
1159731923 18:72037786-72037808 GGGCAGAGCTGGCTGGAGAATGG - Intergenic
1159919526 18:74215050-74215072 GGGCAGAACTCCCAGCAGAAGGG - Intergenic
1160462176 18:79047590-79047612 CGGAAGGTTTTCCGGGAGAATGG + Intergenic
1160462372 18:79048734-79048756 GGGCAGAGCCTCTGGGAGAAAGG + Intergenic
1161511900 19:4676649-4676671 GGGTAGATCTGCGGGGAGACAGG + Exonic
1162364874 19:10242550-10242572 GGGCAGATTTTCCGAGAGGAAGG - Intergenic
1162588942 19:11578369-11578391 GGGCAGGACTTCCTGGAAAAGGG - Intronic
1162767437 19:12928535-12928557 CGACAGATCTTCCTGGAGATGGG - Exonic
1166295767 19:41888572-41888594 GGGCAGGTGTTCAGGGAGAATGG - Intronic
1167491380 19:49794593-49794615 GGACAGAGCTTCCTGGAGAAGGG + Intronic
1167521389 19:49958244-49958266 GGGCTGAGGTTCAGGGAGAAAGG - Intronic
1167743682 19:51339135-51339157 GGGCAGGTCTGCGGAGAGAAGGG + Exonic
925200823 2:1966466-1966488 GGTCTGATCTTCCTGGAGAGAGG + Intronic
927021276 2:19020098-19020120 GGACAGAGCTCCTGGGAGAAGGG - Intergenic
929596927 2:43181797-43181819 GGGCAGATTTGTTGGGAGAAGGG + Intergenic
929814629 2:45221144-45221166 GAGAAGTTCTTCCAGGAGAAGGG + Intergenic
929900863 2:46002291-46002313 GGGCAGAAAATCCGGGTGAAGGG + Intronic
930092809 2:47543711-47543733 GGGCTGATCTTCCAGGAGCTGGG + Intronic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
934149099 2:89128453-89128475 TGGCAGAACTTGCAGGAGAATGG - Intergenic
934218196 2:90053589-90053611 TGGCAGAACTTGCAGGAGAATGG + Intergenic
936489287 2:112956617-112956639 GGGCAGATATTCCTGGACCAGGG - Intergenic
937251012 2:120523811-120523833 GAGTAGATCTTCCTGGAGTAGGG + Intergenic
939765225 2:146240013-146240035 GGTTAGACCTTCAGGGAGAAAGG - Intergenic
939933410 2:148259081-148259103 GGGCAAGTCATCCGGGAGATGGG - Intronic
943669007 2:190640998-190641020 GGACAGATCTGCAGGGAAAAGGG - Intergenic
946156237 2:217808469-217808491 GGGCAGACCTTCCAGCTGAATGG + Intronic
946186106 2:217981263-217981285 GGGCTGATCTGCCTGGAGAAAGG - Intronic
1169723068 20:8700208-8700230 GGGCAGGTCTTCCTGGCGGATGG - Intronic
1171956528 20:31468119-31468141 GTGCAGATCATGCAGGAGAAAGG - Intronic
1172539400 20:35699337-35699359 GGGCAGCACTTCCGGGAGCCTGG - Exonic
1173223775 20:41149824-41149846 GGGCAGAGCTTCAAGGAGAGAGG + Intronic
1174066485 20:47869346-47869368 GGACAGTTCTTCCTGGAGGAAGG - Intergenic
1175303180 20:57957345-57957367 AGGCAGATCTGCCGGGATTAGGG + Intergenic
1176288212 21:5030309-5030331 GGGCAGTTCATCGGGGAGAATGG - Intronic
1179868969 21:44233166-44233188 GGGCAGTTCATCGGGGAGAATGG + Intronic
1179900561 21:44391329-44391351 GTGAAGCTCTTCCTGGAGAACGG + Exonic
1181013406 22:20055055-20055077 GGGCAGCACTTCGGGGAGGAAGG + Intronic
1184644072 22:45886586-45886608 GGGAAGAACTGCCGGGAGAGGGG - Intergenic
949226373 3:1700061-1700083 GGGAAGATCTGCCTGCAGAAGGG + Intergenic
950017886 3:9767155-9767177 GGGGAAAACTTCCTGGAGAATGG - Intronic
950468291 3:13168713-13168735 GGACAGATCTTCCAGGAAGACGG - Intergenic
953195327 3:40726853-40726875 GGGCAGAGCTCTCAGGAGAAAGG + Intergenic
953373385 3:42408370-42408392 GGGCACAGCTCCCTGGAGAATGG - Intronic
954466429 3:50657857-50657879 GGGCAGATGTGCAGGGAGACTGG + Intergenic
957256571 3:77844983-77845005 GGACAGAGCATCTGGGAGAAAGG - Intergenic
964435099 3:156643276-156643298 AGGCAGTCCTTTCGGGAGAATGG + Intergenic
967155735 3:186690256-186690278 GAGCAGTTCTTCCCGGAGAGCGG - Intergenic
969543217 4:7806953-7806975 GTTCAGATCTTTCGGGGGAAGGG + Intronic
969582514 4:8073396-8073418 GGGCTGTTCTTCGCGGAGAACGG + Intronic
969584699 4:8084993-8085015 GGGCAGAGCTTCAGGGACACAGG + Intronic
969884668 4:10204742-10204764 GGGCAGTTCTTCAGGGACCAAGG + Intergenic
970052452 4:11930086-11930108 GTGCAGCTCTTCCTTGAGAAAGG + Intergenic
972669823 4:41204512-41204534 GGGCAAAGCTTCCAGGAGAAGGG - Intronic
975177949 4:71309245-71309267 GGGCAGAGCACCTGGGAGAAGGG + Intronic
979200537 4:117972927-117972949 GGGCATATTTTCCAGGAGACTGG - Intergenic
979324234 4:119360675-119360697 GGGCAGCTCTTCCTGGATAAAGG - Intergenic
983242073 4:165245375-165245397 GGGCAGCTCTTCCTGGATAAAGG - Intronic
983264943 4:165498966-165498988 TGGCAGATCTTCTGTCAGAATGG - Intergenic
985989489 5:3543701-3543723 TGGCAGAGCTTCCAGGAGACAGG - Intergenic
986709381 5:10477576-10477598 GGGCAGATGCTCCGTGAGGATGG + Intergenic
987278249 5:16385494-16385516 GGGCAGATTTTCCAGTAGTAAGG + Intergenic
987666661 5:20950950-20950972 GGGAGGATGTTGCGGGAGAATGG - Intergenic
989136580 5:38161864-38161886 GGGCAGATCTCTTGGAAGAAGGG - Intergenic
989814694 5:45722031-45722053 GTGCTTATCTTCGGGGAGAATGG + Intergenic
999324470 5:150635028-150635050 GGGCACATGCTCCTGGAGAATGG - Intronic
1003544830 6:7051151-7051173 GGGCAGAACTTCGGGGACATGGG + Intergenic
1005990493 6:30899008-30899030 GGGGAGTTCTTCCGGGACCAGGG + Exonic
1015012941 6:128374448-128374470 GGGCAGATGTTTGGGAAGAATGG - Intronic
1017694777 6:157003559-157003581 GGGCTTATCTGCCTGGAGAAGGG + Intronic
1018995542 6:168707111-168707133 GGGCAGATCTGGCAGGAGAAGGG - Intergenic
1022148429 7:27572003-27572025 GGCCATAACTTCTGGGAGAAAGG - Intronic
1023538238 7:41236818-41236840 GAGCAGAGCTCCTGGGAGAAAGG - Intergenic
1029371854 7:100155364-100155386 GGGCTGCTCTTGCGGGAGAGGGG + Exonic
1029706935 7:102281012-102281034 GGGCAGATCCTCTGAGAGCATGG + Intronic
1029983447 7:104900486-104900508 ATGCAGATCTTCGGTGAGAAGGG - Intronic
1031123053 7:117742944-117742966 GGGCAGGGCTGCAGGGAGAATGG - Intronic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1033686068 7:143642612-143642634 GAGCAGAAATTCTGGGAGAAGGG - Intronic
1033689670 7:143724703-143724725 GAGCAGAAATTCTGGGAGAAGGG + Exonic
1033698545 7:143815009-143815031 GAGCAGAAATTCTGGGAGAAGGG + Intergenic
1034155771 7:148955043-148955065 GTGCTCATCTTCCTGGAGAAGGG + Intergenic
1034155938 7:148956188-148956210 GTGCTCATCTTCCTGGAGAAGGG - Intergenic
1040546009 8:48398242-48398264 AGGCAGATCTTCCCTGACAATGG - Intergenic
1040554965 8:48470115-48470137 GGTCAGATCTTCCAGGAGACCGG + Intergenic
1043324667 8:79034692-79034714 GGACAGAGCTTCCAGAAGAAGGG + Intergenic
1045280690 8:100747122-100747144 AGCCAGCTCTTCCGTGAGAAGGG + Intergenic
1050565142 9:6874616-6874638 GGGCAGTTCTTCTGGGAAAGTGG + Intronic
1052652006 9:31316685-31316707 GGGCAGTTCTTCCTTCAGAAAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058157724 9:101533841-101533863 AGGCAGAACTTCCGGGAGGCGGG - Exonic
1060217434 9:121746732-121746754 GGGAAGCACTTCCTGGAGAATGG + Intronic
1060828182 9:126698294-126698316 GGGCAGATGTGCTGGGAGAGAGG - Exonic
1061092033 9:128431930-128431952 GGGCAGCCCTTCCAGGAGATGGG + Intronic
1061486462 9:130922928-130922950 GGGTAAAGCTTCCTGGAGAAGGG - Intronic
1062244257 9:135556026-135556048 GGGCAAAGCTTCGGAGAGAAAGG - Intergenic
1189767185 X:44383866-44383888 GAGCAAATCATCCGGGAGAGAGG - Intergenic
1190915593 X:54809094-54809116 TGGCACATCTTCCTGGAGAAGGG + Intronic
1199595912 X:149505552-149505574 GGGCAGGGCTTCCAGGTGAAAGG - Intronic
1200106832 X:153718876-153718898 GAGCAGATCCTCCTGGAGGATGG - Intronic
1200779347 Y:7200166-7200188 GGGCATCTCTACGGGGAGAAGGG - Intergenic