ID: 1089564359

View in Genome Browser
Species Human (GRCh38)
Location 11:119363285-119363307
Sequence CCATTTATGCAGCGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089564359_1089564366 -6 Left 1089564359 11:119363285-119363307 CCCGCTGCCCGCTGCATAAATGG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1089564366 11:119363302-119363324 AAATGGAGAGGACGGAAAGAAGG 0: 1
1: 0
2: 3
3: 84
4: 1163
1089564359_1089564368 -4 Left 1089564359 11:119363285-119363307 CCCGCTGCCCGCTGCATAAATGG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1089564368 11:119363304-119363326 ATGGAGAGGACGGAAAGAAGGGG 0: 1
1: 1
2: 0
3: 52
4: 683
1089564359_1089564367 -5 Left 1089564359 11:119363285-119363307 CCCGCTGCCCGCTGCATAAATGG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1089564367 11:119363303-119363325 AATGGAGAGGACGGAAAGAAGGG 0: 1
1: 0
2: 4
3: 86
4: 945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089564359 Original CRISPR CCATTTATGCAGCGGGCAGC GGG (reversed) Intronic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
902652480 1:17845558-17845580 CCCTTTTTACAGCAGGCAGCAGG - Intergenic
915068665 1:153247046-153247068 CCTTTTATGCCGCTGGCAGTGGG - Intergenic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
919354980 1:196510731-196510753 ACATTGAAGCAGCTGGCAGCTGG - Intronic
919638716 1:200029288-200029310 CTATTTTGGCAGCGGCCAGCTGG - Intronic
921189026 1:212693580-212693602 CCATTTCTGAAAAGGGCAGCTGG + Intronic
1069987629 10:72295381-72295403 GGATTTGTGCAGTGGGCAGCAGG - Intergenic
1074324246 10:112432465-112432487 TCCTTTATTCAGAGGGCAGCAGG + Exonic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1083318045 11:61828323-61828345 CCGTCTGTGCAGCGAGCAGCCGG + Exonic
1083923823 11:65794170-65794192 CCATGTCTTCAGAGGGCAGCTGG - Exonic
1086259361 11:84919470-84919492 GAATTTATGCAGTAGGCAGCAGG + Intronic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1089898948 11:121961417-121961439 TCACTGATGCTGCGGGCAGCAGG - Intergenic
1091268310 11:134287937-134287959 CCATTTATGCTGTAGGCAGTGGG + Intronic
1101539855 12:105654941-105654963 CCATTTATGAACCAGGAAGCAGG + Intergenic
1104888816 12:132129264-132129286 CCACTGATGCTGGGGGCAGCGGG + Intronic
1104949214 12:132431501-132431523 GCATTCAGGCAGCGGGGAGCGGG - Intergenic
1106158848 13:27182962-27182984 CCCTTTATTCAGAAGGCAGCAGG - Intergenic
1111924207 13:94445833-94445855 CCACTTCTGCATGGGGCAGCGGG - Intronic
1113374444 13:109751071-109751093 CCATCTATGAAGCAGGCAGCAGG + Intergenic
1116187035 14:41610031-41610053 CCATGTATGCAGCGGGCTTTGGG + Intronic
1116605442 14:46987475-46987497 TCCTTTATGCAGAGGGCAGAAGG + Intronic
1117904282 14:60568193-60568215 CCATTTATGCAGTTGCCAACAGG - Intergenic
1120640844 14:87010594-87010616 CCAGTTATGCAGCTTGCAGATGG + Intergenic
1122122071 14:99560097-99560119 GCATCTATCCAGGGGGCAGCTGG - Intronic
1132942878 16:2516976-2516998 CCTTTTCTACAGAGGGCAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135207423 16:20494849-20494871 CCATATTTGCAGCAGTCAGCAGG - Intergenic
1135211462 16:20528783-20528805 CCATATTTGCAGCAGTCAGCAGG + Intergenic
1146254889 17:31386151-31386173 CCATTTCTGCAGCTGACAGAAGG + Intergenic
1148049975 17:44765152-44765174 CCATTTATCAAGAGGGCAGCGGG - Intronic
1159516320 18:69463127-69463149 CCATCTATGAACCGGGAAGCAGG - Intronic
1161423849 19:4191226-4191248 CCAGTTTCGCAGCAGGCAGCCGG + Intronic
1161683249 19:5690954-5690976 GCCTTTATTAAGCGGGCAGCGGG + Intronic
1162352223 19:10157826-10157848 CCACCTGTGCAGCGGGGAGCGGG - Intronic
1163831258 19:19548178-19548200 CCAGGCATGGAGCGGGCAGCTGG + Intergenic
926041429 2:9676305-9676327 CCATTGAGGCAGAGGGCAGGTGG - Intergenic
933982392 2:87562377-87562399 CCATTTATGAAGCAGAGAGCAGG - Intergenic
934086882 2:88517359-88517381 CTATTTATAGAGCGGGGAGCTGG - Intergenic
936311449 2:111388416-111388438 CCATTTATGAAGCAGAGAGCAGG + Intergenic
937655861 2:124375290-124375312 CCAGTTATGCTGGGGTCAGCAGG - Intronic
945829893 2:214771067-214771089 GCATTTATGCAGCGGGATGAAGG + Intronic
1175154172 20:56958310-56958332 GCATAAATGCAGCGGCCAGCGGG - Intergenic
1175991868 20:62793844-62793866 CCATCTGTGCAGGGGGCCGCTGG - Intergenic
1177630770 21:23724812-23724834 CCATTTTTGAAGCAGGAAGCAGG - Intergenic
1180954554 22:19735903-19735925 ACATTTATCCCGCGGGCGGCTGG + Intergenic
1182109967 22:27716068-27716090 TAATTTATGCAGGGTGCAGCGGG + Intergenic
949970637 3:9400015-9400037 CCATTAATGCTGCTGGCTGCAGG + Intronic
950936289 3:16842704-16842726 TCATGTATGCAGGGGGCAGCTGG + Intronic
956614652 3:71158478-71158500 CCATTTAGGCAGGGGTGAGCAGG + Intronic
957351922 3:79035278-79035300 CTATTTTTGCAGTAGGCAGCAGG + Intronic
960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG + Intronic
968995311 4:3941607-3941629 CCATAAATCCAGCGGGCAGGCGG - Intergenic
971601413 4:28596213-28596235 CCATGAATGCAGCTGGCAGGTGG + Intergenic
978920073 4:114173485-114173507 CCATCTATGAAGCGTGAAGCAGG + Intergenic
980797601 4:137704614-137704636 CCATCTATGAAGCAGGAAGCAGG + Intergenic
985542465 5:493308-493330 CCATTTAAGCACAGAGCAGCGGG + Intronic
987374045 5:17217905-17217927 CCCTTCATGCAGCGGGCAGCAGG + Intronic
990734090 5:58841095-58841117 CCATGTCTGCAGGGGGCAGGGGG + Intronic
993482325 5:88439044-88439066 CCATCTATGAAGCAGGAAGCAGG - Intergenic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1002104884 5:176875115-176875137 ACATTTATGGAACAGGCAGCTGG - Intronic
1002558347 5:180061971-180061993 CCATTGATGAAGCAGACAGCGGG - Intronic
1007019264 6:38503239-38503261 TCATTTCTGCAGAAGGCAGCGGG - Intronic
1007918660 6:45586406-45586428 CTGTTTCTGCAACGGGCAGCAGG - Intronic
1008454008 6:51687497-51687519 CCATCTATTCAGTGGCCAGCAGG + Intronic
1008929419 6:56922679-56922701 CCATTCATGCAGCTGGAAGGAGG - Intronic
1014895542 6:126895412-126895434 CCAATTATGCAGTTGGTAGCTGG - Intergenic
1016667793 6:146663381-146663403 CCATTTATGAACCAGGGAGCAGG - Intronic
1018190228 6:161304083-161304105 CCATTTCGCCAGCGGGCAGCTGG - Intergenic
1021312068 7:19108152-19108174 CCTTTTAGGCAGCGGGGACCAGG - Intronic
1024949677 7:54846729-54846751 CCATAAATGCAGCTTGCAGCGGG + Intergenic
1025110590 7:56212932-56212954 CCATTTATGCATAGGGAAACTGG - Intergenic
1026462670 7:70628844-70628866 CCATTTCTGAACCGGGCAGCTGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1037758006 8:21723834-21723856 CCGCTTGTGCAGCGGGCATCTGG + Intronic
1038212943 8:25536728-25536750 ATATTTATGCAGCAGGCAGGGGG + Intergenic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1045932756 8:107646424-107646446 CCATCTAAGCAGCTGCCAGCAGG - Intergenic
1046393089 8:113602486-113602508 CCATATATGCAGAGAGCAGAAGG - Intronic
1048495046 8:134928188-134928210 GCCTTTATGCAGCTGGAAGCAGG - Intergenic
1050570102 9:6928876-6928898 CCAAACATGCAGCCGGCAGCTGG - Intronic
1051535960 9:18158090-18158112 CCATTTATACAGAGAGCAGGAGG - Intergenic
1055480054 9:76700770-76700792 GCCTTTATGGAGCAGGCAGCAGG - Intronic
1059339013 9:113586925-113586947 CCATTTATGCAGCACCCACCAGG - Intronic
1061072981 9:128323073-128323095 CCCTTTCTGCAGCGGGGAGGTGG - Exonic
1061397547 9:130351633-130351655 CCTCTAAGGCAGCGGGCAGCTGG - Intronic
1062169402 9:135126622-135126644 CCATTTATTCATCACGCAGCAGG + Intergenic
1186449586 X:9660993-9661015 CCATCTATGAATCGGGAAGCGGG + Intronic
1187473599 X:19590298-19590320 CCATTCATCCAGCAGGCTGCTGG - Intronic
1197926368 X:131650764-131650786 CCCTTTCTGCAGTAGGCAGCAGG + Intergenic