ID: 1089565314

View in Genome Browser
Species Human (GRCh38)
Location 11:119368236-119368258
Sequence CAGGAAGTTCAACCTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089565310_1089565314 -3 Left 1089565310 11:119368216-119368238 CCAACACAGATTCATGACCTCAG 0: 1
1: 0
2: 2
3: 15
4: 157
Right 1089565314 11:119368236-119368258 CAGGAAGTTCAACCTCCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 99
1089565309_1089565314 10 Left 1089565309 11:119368203-119368225 CCTTCTCATGCTGCCAACACAGA 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1089565314 11:119368236-119368258 CAGGAAGTTCAACCTCCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 99
1089565308_1089565314 20 Left 1089565308 11:119368193-119368215 CCTTTAGTGACCTTCTCATGCTG 0: 1
1: 0
2: 3
3: 15
4: 116
Right 1089565314 11:119368236-119368258 CAGGAAGTTCAACCTCCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089565314 Original CRISPR CAGGAAGTTCAACCTCCTTA GGG Intronic
904710029 1:32423378-32423400 TAGATGGTTCAACCTCCTTAGGG + Intergenic
910109886 1:83671702-83671724 CAGGAACTTCAAGCTCTTCAAGG + Intergenic
912808836 1:112778146-112778168 AAGAAAGTTCAACATCCGTATGG + Intergenic
915244051 1:154543862-154543884 CAGGCAGTTCAGCCTCCTGCAGG + Intronic
915403554 1:155642034-155642056 CAGGAGGTCTAACCTCCTCAGGG - Intergenic
915437731 1:155921505-155921527 CAGCCAGTTCAACCTCCCTACGG - Exonic
916818298 1:168374135-168374157 CAGGAATTACAACCTGCTGAAGG + Intergenic
917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG + Intronic
921179477 1:212620324-212620346 CAGAAAGTTCAACTTCCAAAGGG + Exonic
923200073 1:231703094-231703116 CAGGATTTTCTACCTCCTTTTGG - Intronic
1065747222 10:28853526-28853548 CAGGAAGTCCACCCTGCTTCTGG - Intronic
1066003562 10:31127186-31127208 CAGGAAGTTCAGACCCCTCAGGG - Intergenic
1073447835 10:103591788-103591810 CTGGAAGTTTGACGTCCTTATGG - Exonic
1074174943 10:110989567-110989589 CAGGTAGTTCTACCTTCTTCTGG + Intronic
1075140784 10:119833285-119833307 CTGGAAATTAAACCTCCCTAGGG - Intronic
1078183392 11:9030829-9030851 CAGGAAGTTCGACCAGCTTCAGG + Exonic
1087216518 11:95501235-95501257 CAGCATGTTCACCCTCATTATGG - Intergenic
1087581361 11:100059590-100059612 AAAGATGTTCAACCTCCTTAGGG + Intronic
1089565314 11:119368236-119368258 CAGGAAGTTCAACCTCCTTAGGG + Intronic
1090716172 11:129433372-129433394 CCTGCAGTCCAACCTCCTTAGGG + Intronic
1091095552 11:132818370-132818392 CAGGAAGTCCACCCACGTTACGG - Intronic
1091781459 12:3216800-3216822 AAGGAGGTTCCACCTCCCTAGGG - Intronic
1093827014 12:23705377-23705399 CAGGAGGTTCAAACACTTTATGG - Intronic
1099233309 12:80052576-80052598 CAGGAAGTTCAAAGGCTTTAAGG - Intergenic
1101176351 12:102155645-102155667 CAGGAACTTCAACACCCTTTGGG + Intronic
1102243970 12:111343311-111343333 TAGGAAGCTCAACCTACTTCAGG - Intronic
1103339810 12:120215384-120215406 CAAGAAGTACAACCTCCTCCAGG + Exonic
1106656898 13:31756173-31756195 CAGCAGGTTCTACCTCCTTTAGG + Intronic
1111852943 13:93600004-93600026 CTGGAAGTTCAATCTTCTAAAGG - Intronic
1112497405 13:99915928-99915950 CAGGATTTTCATTCTCCTTAGGG - Intergenic
1118374191 14:65162727-65162749 CAGGAGGTCCAATCTCCTGAGGG - Intergenic
1121212830 14:92221804-92221826 CAGGAAGATCACCCCCCTTGGGG - Intergenic
1123929426 15:25155360-25155382 TAAGGAGTTCAACCTCCTTAAGG - Intergenic
1127583778 15:60362333-60362355 CAGGAAGTTGAACGCCCATAAGG - Intronic
1130803933 15:87298457-87298479 CATGATGTTATACCTCCTTATGG - Intergenic
1135209974 16:20516996-20517018 CAGGTTCTGCAACCTCCTTATGG - Intergenic
1137684682 16:50378587-50378609 CCTGAAGCTCAACCTCATTAGGG - Intergenic
1137877116 16:52007195-52007217 CAGGAAGTTTATTCTGCTTAAGG - Intronic
1140428125 16:74878193-74878215 AGGGAAGTTCAACCTCCCTGGGG + Intronic
1141279335 16:82616802-82616824 CAGGAAGTGCCACCTCCTCCAGG - Intergenic
1145870613 17:28270258-28270280 CACATGGTTCAACCTCCTTAGGG + Intergenic
1146223744 17:31048666-31048688 CAGATGGTTCAACCTCCTTAGGG + Intergenic
1146430206 17:32786100-32786122 CAGGAACTGCAACCTACTTCTGG - Intronic
1146811907 17:35910562-35910584 GAGAAGGTTCTACCTCCTTAGGG + Intergenic
1147232622 17:39030279-39030301 GAGAAGGTTCTACCTCCTTAGGG - Intergenic
1147232635 17:39030339-39030361 CAGATGGTTCAACCTCCTTAGGG - Intergenic
1147922124 17:43924142-43924164 CAGATGGTTCAACCTCCTTAGGG + Intergenic
1149096150 17:52843245-52843267 AAGGAAGTACAACCTTCTTTAGG - Intergenic
1150784379 17:68150950-68150972 CAGATGGTTCAGCCTCCTTAGGG + Intergenic
1151877382 17:76874574-76874596 CTGGAGGTTCAACTTCCTCAAGG - Intronic
1155068879 18:22295454-22295476 GAGGAAGTTCAACCACAGTAAGG - Intergenic
1155932943 18:31725537-31725559 GAGAAGGTTCTACCTCCTTAGGG - Intergenic
1155932956 18:31725596-31725618 CAGATGGTTCAACCTCCTTAGGG - Intergenic
1158525363 18:58208367-58208389 AAGGAGGCTCAACCTACTTATGG - Intronic
1161775302 19:6258808-6258830 CAGGACCCTCAACCTCCTTTGGG + Intronic
1162364933 19:10242805-10242827 CAGAGAGTCCAACCTCCTTGAGG - Intergenic
1162496876 19:11028297-11028319 CAGGAGGTTAAACATCCTTCAGG + Intronic
1163768194 19:19175175-19175197 CGGGAAGTTCAGCCTCCTAGCGG - Intronic
1166050381 19:40255659-40255681 GAGGAGGTTCAACATCCTCAGGG + Intronic
927760318 2:25747171-25747193 CAGCAAGTTCCACATCCTCAAGG - Intronic
930259608 2:49129830-49129852 CCTGAAGTTCAACCTCAGTAGGG - Intronic
933309419 2:80641648-80641670 CAGGAAGTTCACCATTCTGAAGG + Intronic
939519070 2:143206102-143206124 CAGGAAATCCAAGCTCCTTCAGG - Intronic
940202267 2:151164680-151164702 CAGCAAGTTCAACAGCTTTAAGG + Intergenic
946280787 2:218664207-218664229 CAGGAACTGCCACCTCCTGAGGG - Exonic
1176042923 20:63074905-63074927 CAGGAAGTGCCAGTTCCTTAAGG + Intergenic
1177832839 21:26158647-26158669 AATGAAGTTCAAACTCATTAAGG + Intronic
1180593756 22:16960887-16960909 CAGGAAGTGAAAACTCCTCAGGG - Intergenic
1182682951 22:32096749-32096771 AATGCAGGTCAACCTCCTTAGGG + Intronic
1183032163 22:35114412-35114434 CAGGAAGTTCCTCTTCCTAAAGG - Intergenic
1184034730 22:41913048-41913070 CAGGAGGCTCCACCTCCTGAAGG + Intronic
953244127 3:41175453-41175475 CAGAAACTTCAAATTCCTTAGGG + Intergenic
961240496 3:125406682-125406704 CAGGAGGCTCAAGCTACTTAGGG - Intergenic
962784638 3:138755931-138755953 CCCAATGTTCAACCTCCTTATGG - Exonic
962949613 3:140205790-140205812 CAGGGAGTAAAAGCTCCTTAGGG - Intronic
966160708 3:176964938-176964960 CAGGAAATGCAATCTCCTTTTGG - Intergenic
967555232 3:190849257-190849279 CAGGAATCTCAGCCTCCTTGGGG - Intergenic
967841608 3:194009395-194009417 CAGGTAGTTCAACTTCTTCAGGG + Intergenic
969055088 4:4396657-4396679 CAGGAAGCTCAAGGTCATTAGGG - Intronic
969055100 4:4396725-4396747 CAGGAAGCTCAAGGTCATTAGGG - Intronic
969139527 4:5056341-5056363 AAGGAATTGCAAGCTCCTTAAGG + Intronic
979756299 4:124344123-124344145 CAGGTGTTTCAACGTCCTTAAGG + Intergenic
980734537 4:136867728-136867750 CCGGCAGTTCAAACTCCTAAGGG - Intergenic
990621038 5:57558603-57558625 CAGGAAGTTAAAACCACTTAGGG - Intergenic
990788088 5:59445446-59445468 CAGGCAGTTCAGCCTGCATAGGG - Intronic
1000342026 5:160285310-160285332 CATGGAGTTCAAACTCCTTGAGG + Intronic
1001531137 5:172462751-172462773 CAGGCTGTTCAATTTCCTTATGG - Intergenic
1016080447 6:139848845-139848867 AAAAAAGTTCAAACTCCTTAGGG + Intergenic
1018680419 6:166259682-166259704 CAGAAAGTTCAACCGAGTTAAGG - Intergenic
1019543696 7:1562735-1562757 CAGGCAGCTCATCCTCCTAAAGG + Intergenic
1020270445 7:6591657-6591679 CAAGAAGTTGAAGCTCCTGAAGG - Exonic
1022040624 7:26578251-26578273 CAGTAAGTTCTTCCTCCTTCAGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023624600 7:42103321-42103343 AAGGAAGTCCCACCTCCTGAGGG + Intronic
1025315520 7:58021414-58021436 CAGGGAGTTGAACCTCCCTTTGG + Intergenic
1031436737 7:121741442-121741464 CAGCAAGATGAACCTCCTTGGGG - Intergenic
1039017876 8:33172712-33172734 AAGGATGTGCAAACTCCTTACGG + Intergenic
1039946664 8:42135463-42135485 CGGGAACTTCAACATCCTCATGG + Intergenic
1046702346 8:117415396-117415418 CATGAAGCTCAACCTCCAAAAGG - Intergenic
1048103900 8:131386439-131386461 CCAGATGTTCAACCACCTTAGGG - Intergenic
1052263832 9:26548787-26548809 CAGGAAGTTCAGATTCCATAAGG + Intergenic
1053335062 9:37260783-37260805 CAGGGAGTTCAGCTTCCATAAGG - Intronic
1060178720 9:121516821-121516843 AAGGAAGTTCAACTGGCTTACGG - Intergenic
1061902613 9:133680697-133680719 CAGCAACTTCAAGCTCCTGAGGG + Intronic
1192639322 X:72847370-72847392 CAGTAAGTTGAATCTCCTTGGGG + Intronic
1192642389 X:72873435-72873457 CAGTAAGTTGAATCTCCTTGGGG - Intronic
1198303351 X:135353311-135353333 AAGGAAGTTCCACCTCTTGAAGG + Intronic