ID: 1089570183

View in Genome Browser
Species Human (GRCh38)
Location 11:119402652-119402674
Sequence GGTCCCCAAGTACCCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089570177_1089570183 6 Left 1089570177 11:119402623-119402645 CCCTGCCACCATCTGCGTGGTGT No data
Right 1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG No data
1089570178_1089570183 5 Left 1089570178 11:119402624-119402646 CCTGCCACCATCTGCGTGGTGTA No data
Right 1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG No data
1089570179_1089570183 1 Left 1089570179 11:119402628-119402650 CCACCATCTGCGTGGTGTAGTGG No data
Right 1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG No data
1089570181_1089570183 -2 Left 1089570181 11:119402631-119402653 CCATCTGCGTGGTGTAGTGGTGG No data
Right 1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG No data
1089570174_1089570183 30 Left 1089570174 11:119402599-119402621 CCTTGCTGCTTAGGAAGGTGCAG No data
Right 1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089570183 Original CRISPR GGTCCCCAAGTACCCCCAGC TGG Intergenic
No off target data available for this crispr