ID: 1089572602

View in Genome Browser
Species Human (GRCh38)
Location 11:119420360-119420382
Sequence GCAGGTCTCCCGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 214}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089572602_1089572614 23 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572614 11:119420406-119420428 CTTCAAACTGGAGGGGCCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 179
1089572602_1089572609 14 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572609 11:119420397-119420419 CAGTGCCTCCTTCAAACTGGAGG 0: 1
1: 0
2: 2
3: 14
4: 185
1089572602_1089572608 11 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572608 11:119420394-119420416 CAGCAGTGCCTCCTTCAAACTGG 0: 1
1: 0
2: 2
3: 14
4: 170
1089572602_1089572611 16 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572611 11:119420399-119420421 GTGCCTCCTTCAAACTGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 146
1089572602_1089572615 29 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572615 11:119420412-119420434 ACTGGAGGGGCCTGCGGCACAGG 0: 1
1: 0
2: 0
3: 13
4: 180
1089572602_1089572610 15 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572610 11:119420398-119420420 AGTGCCTCCTTCAAACTGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 151
1089572602_1089572616 30 Left 1089572602 11:119420360-119420382 CCTTCTGCCCTCGGGAGACCTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1089572616 11:119420413-119420435 CTGGAGGGGCCTGCGGCACAGGG 0: 1
1: 0
2: 1
3: 24
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089572602 Original CRISPR GCAGGTCTCCCGAGGGCAGA AGG (reversed) Exonic
901125361 1:6925113-6925135 GCAGGGGGCCCAAGGGCAGAAGG + Intronic
901317079 1:8316651-8316673 GCAGAGCTCCGGAGGGGAGAGGG - Intergenic
902858220 1:19224800-19224822 TCAGGCCTGCTGAGGGCAGAGGG - Intronic
903295933 1:22343053-22343075 CCAGGTGTCCCGAGGGCTGCTGG - Intergenic
903768550 1:25749889-25749911 CCAGGTCTCACGGGGGCAGCAGG + Intronic
904080958 1:27872445-27872467 GCAGGGCTCCCGCGGGCTGGCGG + Intergenic
904750222 1:32737294-32737316 GCAGGTCTCCCAAGTGGAAAGGG + Intergenic
906381758 1:45336943-45336965 GCAGATCTTCAGAGGGCAAAGGG + Intronic
907364256 1:53946253-53946275 GCAGGCGACCCGAGGGCCGAGGG - Exonic
907651965 1:56303677-56303699 GCAGTTCTACCAATGGCAGATGG - Intergenic
911158459 1:94658898-94658920 GCAGGTCACCTGAGGTCAGGAGG + Intergenic
912209818 1:107545443-107545465 GCAGGCCTCTAGTGGGCAGAGGG + Intergenic
914419670 1:147517842-147517864 GCAGGACACCAGAGGGCAGCGGG + Intergenic
915285074 1:154847208-154847230 GCAGGCTCCCCGAGGGCAGGGGG - Intronic
916435222 1:164771849-164771871 ACAGGTCTGGCGGGGGCAGATGG - Intronic
918434870 1:184500918-184500940 GCAAGTCTCAAGAGGGAAGAAGG - Intronic
920388753 1:205585933-205585955 GCAGGTGTGGGGAGGGCAGAGGG - Intronic
920550322 1:206855279-206855301 GCAGATCACCTGAGGTCAGAAGG - Intergenic
920980406 1:210829080-210829102 GCATCTCTCCTGAGGGCAGTGGG + Intronic
922013964 1:221623891-221623913 GCAGGTCACCTGAGGTCAGGAGG - Intergenic
922588086 1:226750978-226751000 GCAAGACTCACGAGTGCAGAAGG + Intergenic
924727053 1:246680868-246680890 GCTGGTCCCGCAAGGGCAGAGGG - Intergenic
1063141102 10:3257309-3257331 TCAGGTCCCCCCAGGGCTGAGGG + Intergenic
1063652445 10:7951485-7951507 GCAGGTTTCCCAAGAGCAGCAGG + Intronic
1063790623 10:9442131-9442153 GCTGGTCTCCCCAAGGAAGAAGG + Intergenic
1065402183 10:25317951-25317973 GCAGATCACCCGAGGTCAGGAGG - Intronic
1065725715 10:28666174-28666196 GAAGGGCTGCAGAGGGCAGAGGG - Intergenic
1069650629 10:70044779-70044801 GCAAGTTTCCAGAGGGAAGAAGG + Intergenic
1073175600 10:101554836-101554858 GCTGGTCTCCCCAGGCAAGAAGG + Exonic
1074643597 10:115417779-115417801 GCAGGGCTCTGCAGGGCAGATGG - Intronic
1074656252 10:115591377-115591399 TCTAGTCTCCAGAGGGCAGAAGG - Intronic
1075025773 10:118982079-118982101 GCAGGTCTCCCGGGGGCCAGGGG + Intergenic
1075587424 10:123667794-123667816 GCTGTTCTCAGGAGGGCAGATGG + Intronic
1077076922 11:706187-706209 CCAGGTCTCCCGCGGGCGGGTGG - Exonic
1077116913 11:889333-889355 GCTGGTCGGCCGAGGGAAGAGGG - Intronic
1077140468 11:1022059-1022081 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140476 11:1022096-1022118 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140503 11:1022202-1022224 ACAGGGCTGCAGAGGGCAGAGGG - Intronic
1077158473 11:1101995-1102017 GCCCGTCTCCCGGGGGCGGAAGG + Intergenic
1078466454 11:11553728-11553750 GAAGGGCTCCCGGGGGCAGCTGG - Intronic
1078543507 11:12229715-12229737 CCAGGCCTCCCAAGGGCTGAGGG + Intronic
1078733228 11:13995508-13995530 TCAGGTCTCACGAGAGCTGATGG - Intronic
1079088442 11:17463599-17463621 GCAGGGCTGCCGAGGAGAGATGG + Exonic
1079241857 11:18727315-18727337 GGGGGTCACCCCAGGGCAGAAGG - Intergenic
1081720719 11:45286303-45286325 GCAGCTCTCCCGCCGCCAGAGGG + Exonic
1082846071 11:57726582-57726604 GCAGGACTCCCTATGGCTGAGGG - Intronic
1082928784 11:58578784-58578806 GCAGGTCTCGCGAGGGAGGCGGG - Intergenic
1083294145 11:61706260-61706282 GCTGGGCTCCAGAGGGCAGTGGG + Intronic
1083477934 11:62926031-62926053 GCTGGGCTCCGGAGGGCAGTGGG + Intergenic
1084675234 11:70630224-70630246 GCAGGTGCCCTGAGGCCAGACGG + Intronic
1087743467 11:101915364-101915386 GCCGCTCTCCCGAGGGCCGAGGG - Exonic
1088575945 11:111271509-111271531 GAAGATCTCCCGAGCCCAGAAGG - Intronic
1088583342 11:111335873-111335895 GCAGATCTCCTGAGGGCATGGGG + Intergenic
1089572602 11:119420360-119420382 GCAGGTCTCCCGAGGGCAGAAGG - Exonic
1091558410 12:1593382-1593404 GCACATCTCCCGAGGGCTGACGG - Exonic
1092119944 12:6036755-6036777 GCAGGGCACGAGAGGGCAGAGGG - Intronic
1092239639 12:6828889-6828911 GTAGGGCTCCCGACGGCGGAAGG - Exonic
1096911141 12:54985040-54985062 ACAGCTCTCCTGAGGACAGAAGG - Intergenic
1097008960 12:55939024-55939046 GCAGGACTCACCAGGGAAGAAGG - Intronic
1097041628 12:56159336-56159358 GCAGGCCTGCCGCAGGCAGAGGG + Intronic
1097957478 12:65501104-65501126 GCAGGGCTCTCAAGTGCAGACGG + Intergenic
1101987056 12:109455584-109455606 GCAGGTCTGCTGTGGGCCGACGG - Intronic
1103568916 12:121831149-121831171 ACAGGGCTCCCAAGGGCAGGCGG + Exonic
1103626665 12:122225576-122225598 GACGTCCTCCCGAGGGCAGAAGG - Intronic
1104670721 12:130678185-130678207 ACAGGCCTCCTGAGAGCAGAGGG + Intronic
1106142147 13:27020398-27020420 GCAGCCCTCCCGAGGCCTGAAGG + Intergenic
1106524809 13:30530955-30530977 GAAGGTCACCTGAGGCCAGAAGG + Intronic
1107142821 13:37021493-37021515 GCAGACCTCCTGAGGGTAGAAGG + Exonic
1107779031 13:43879269-43879291 GCAGGTCTCCAGAGGGCACGGGG - Exonic
1110008686 13:70305068-70305090 GGAGGCCTCACAAGGGCAGAAGG - Intergenic
1110514597 13:76395035-76395057 GCAGTACTCACTAGGGCAGATGG - Intergenic
1113598944 13:111554726-111554748 GCAAACCTCCAGAGGGCAGAGGG + Intergenic
1114517293 14:23308243-23308265 GCTGGTCTCCAGGGGGAAGATGG + Intronic
1118879915 14:69817283-69817305 GCAGGTCCCCCGCGGGGAGGGGG + Intergenic
1119640290 14:76309774-76309796 GTGGGTCTCCAGATGGCAGATGG + Intergenic
1119711824 14:76828051-76828073 GCCGGTCTCCAGGGAGCAGAAGG + Intronic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1121957627 14:98228515-98228537 CCAGGACTCCCCAGGGCAGGCGG + Intergenic
1122723937 14:103738273-103738295 GCAGAGCTCCCGAAGGCAAACGG + Intronic
1122792570 14:104190543-104190565 GAGGGTCCCCCCAGGGCAGATGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1122974320 14:105164800-105164822 GCAGGTCTCACGAAGTCAGATGG - Intronic
1125525175 15:40369859-40369881 GCAGGACTCCCAAGGGGAGGAGG + Exonic
1126730224 15:51674819-51674841 AGAGGTCTCCACAGGGCAGAAGG - Intergenic
1128061947 15:64740915-64740937 GCAGGCCGCCCGGGGGCAGTGGG + Exonic
1128257936 15:66212164-66212186 GCAAGCCTCTCCAGGGCAGAGGG + Intronic
1128414639 15:67433727-67433749 GCAGGACTCAGGAGGGCAGGAGG + Intronic
1131051244 15:89349491-89349513 GCAGGTCTCTCGGGGAGAGAGGG + Intergenic
1132547597 16:540397-540419 GGAGGGCTCCCGGGGGCAGAGGG + Intronic
1132904172 16:2273704-2273726 GCAGGGCTCCCGTGAGCAGACGG - Intergenic
1133167414 16:3958000-3958022 GCAGCTCTCGGGAGGGCAGCTGG + Intronic
1135752573 16:25068779-25068801 GCAGGTCATCCGAGGAGAGAGGG - Intergenic
1138514223 16:57527080-57527102 CCAGGTCACCCCAGGGAAGAGGG + Intronic
1139029053 16:62856847-62856869 GCATGTCTTCCGCGTGCAGAGGG - Intergenic
1140135043 16:72198502-72198524 GCAGCTCTCCCCAGGGCAGGGGG - Intergenic
1141948043 16:87323678-87323700 GCAGGTCTGCAGAGGACAGACGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143033679 17:3982356-3982378 GAAGGTTTCCCCTGGGCAGAAGG - Intergenic
1143152244 17:4814870-4814892 TCAGTTCTCCTTAGGGCAGAGGG - Intronic
1145969659 17:28949688-28949710 GCAGGAGCCCCGAGGGCAGCGGG + Intronic
1147137716 17:38443745-38443767 GAAAGTCTCCCGGGGGCACATGG - Intronic
1148351585 17:46945366-46945388 GCAGGTCTTCCTAGGACAGTAGG - Intronic
1148391558 17:47276416-47276438 GCAGGCCTGGGGAGGGCAGAGGG + Intronic
1148756751 17:49977116-49977138 GCAGTTCTCCCAGGGGCAGAAGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1151265905 17:72954752-72954774 GCCGGGCTCCCGAGGAGAGAAGG - Intronic
1151827180 17:76529985-76530007 GGAGGTCCCCTGAGGGCAGCTGG - Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152480296 17:80546823-80546845 GCAGGCCTCCCAAAGGCAGGCGG + Intronic
1152529525 17:80909105-80909127 GCAGCTCCCACGTGGGCAGAGGG + Intronic
1152590080 17:81207313-81207335 GCAGGTCCCGCGAGGACAGAGGG + Intronic
1152739231 17:82011837-82011859 GCAGGGCTCCAGAGGGGAGCAGG - Intronic
1153136333 18:1921516-1921538 GCAGGACTCCCTATGGCTGAGGG + Intergenic
1153522758 18:5967809-5967831 GCAGGACTCCCTGGGGCAGGAGG + Intronic
1153769705 18:8405482-8405504 GCAGGTCTTCTTAGGGAAGATGG - Intronic
1154040459 18:10849816-10849838 GCAGGTCTCCCGAAGAAAAATGG - Intronic
1156177501 18:34564066-34564088 TTAGGTCTCCAGAAGGCAGAAGG + Intronic
1157700870 18:49761056-49761078 GGAGGTCTGGCGAGGGCAGCAGG - Intergenic
1157792717 18:50546788-50546810 GCCGGTCTCTCGAGGGCAGATGG - Intergenic
1157807906 18:50672117-50672139 TCAGGTCTCCATAGTGCAGATGG + Intronic
1160403366 18:78628018-78628040 GCATGTGGCCCGAGGGCTGACGG - Intergenic
1160812342 19:1018235-1018257 GGAGGTCTCCCGAGGGCCCCTGG + Intronic
1161022019 19:2015148-2015170 GCAGGGGTCCCGGGGACAGAGGG + Intronic
1161135916 19:2619752-2619774 GCAGGGCTGCCGGGGGGAGATGG + Intronic
1161313946 19:3609199-3609221 GCAGGTGTGCCCAGGGCAGGGGG - Intergenic
1161597100 19:5156184-5156206 GCAGGTGGCCCAAGGGTAGAGGG - Intergenic
1161613751 19:5258119-5258141 GCAGGGCTCCTGTGGGAAGATGG + Exonic
1162431734 19:10632894-10632916 GCAGATCTCCTGAGGCCAGGAGG - Intronic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1166095716 19:40537774-40537796 GCAGGTCTCCCAGGGCCAGGTGG + Intronic
1168267775 19:55231749-55231771 GCTGGTATCCCGAGGCCAGGAGG - Intronic
1168724012 19:58570835-58570857 GCAAGGCTGCCCAGGGCAGAGGG - Intronic
928396197 2:30944889-30944911 GCAGCTCTCCCCAGAGCAGAAGG - Exonic
928403234 2:30994307-30994329 TCAGGTTTCCCGAGTGCAGGAGG - Intronic
928418759 2:31121127-31121149 GCTGGGCTCCCGAGTTCAGAAGG - Intronic
929572063 2:43028839-43028861 GAAGGGCTTCCTAGGGCAGATGG + Intergenic
933704931 2:85282680-85282702 GCAGGGCTCCGGAGCCCAGAAGG + Intronic
934161241 2:89251622-89251644 GCAGGTCACCTGAGGTCAGGAGG - Intergenic
934206037 2:89930807-89930829 GCAGGTCACCTGAGGTCAGGAGG + Intergenic
934714938 2:96537814-96537836 GCAGGACCCCCGAGGGCCCAGGG + Intronic
938740070 2:134222720-134222742 GCAGGACTCCCTATGGCTGAGGG + Intronic
939697214 2:145341720-145341742 GCAGATCTGCCTAAGGCAGATGG + Intergenic
942211949 2:173680024-173680046 GCTGGTCACCCCATGGCAGAAGG - Intergenic
944764060 2:202846568-202846590 GCAGGTCAAAGGAGGGCAGAAGG + Intronic
946474224 2:219992213-219992235 GCAGGGCTCCAGAGTGCAGAGGG + Intergenic
948579804 2:238978623-238978645 ACAAGTCTCCCTAGGGCATATGG + Intergenic
948710254 2:239820879-239820901 GCAGGGCTTCCAAGGACAGATGG + Intergenic
1169533195 20:6507321-6507343 GCAGGTGTCCTGAGGCCATATGG + Intergenic
1172871234 20:38136700-38136722 GCAGGTGTGAGGAGGGCAGAGGG - Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1174368111 20:50068529-50068551 GCAGGGCTGGCGTGGGCAGATGG + Intergenic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1176238558 20:64065388-64065410 TCAGGTCACCTTAGGGCAGAGGG + Intronic
1176243083 20:64084015-64084037 GCAGGTCGCCGAAGAGCAGATGG + Exonic
1179021362 21:37643783-37643805 AAAGGTCTCCTGAAGGCAGAGGG + Intronic
1181162871 22:20968049-20968071 GGAGGCCTACCGAGTGCAGAGGG - Intronic
1182737703 22:32542898-32542920 GCAGGGCTCCCGTGGCCAGTGGG - Intronic
1182892822 22:33833015-33833037 GCAGTTCTCCCGAAGGATGAAGG - Intronic
1183076878 22:35432867-35432889 GCAGGTGTCTCGGGGGCAGATGG + Intergenic
1183588783 22:38768141-38768163 ACAGGGCCCCTGAGGGCAGAGGG - Intronic
1183731645 22:39621812-39621834 GGGGGTCTCCCTAGGGCAGTGGG - Intronic
1183832044 22:40423480-40423502 GCAGGACTCCAAAGGGCACAGGG + Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185163265 22:49242522-49242544 GCATCTCTCCCCAGGGAAGAAGG + Intergenic
950196845 3:11015436-11015458 ACAGCTGTCCCGAGGGCAGCGGG + Intronic
953385108 3:42501929-42501951 GCAGGTCTCCCGAGGCTTGAAGG + Intronic
959983781 3:112549582-112549604 GCAGGTCACCTGAGGTCAGGAGG + Intronic
961819496 3:129567973-129567995 GGAGCTCTCCCGTGGACAGAGGG + Intronic
962677634 3:137768510-137768532 CCAGGTCTAAGGAGGGCAGATGG - Intergenic
964145045 3:153449894-153449916 GCAGGTCACCTGAGGTCAGGAGG - Intergenic
965588123 3:170337060-170337082 GCAGATCACCTGAGGTCAGAAGG - Intergenic
967050369 3:185777815-185777837 GCAGATCTCCTGAGGTCAGGAGG + Intronic
967931890 3:194695910-194695932 GCTGGTGTCCCCAGGGCAGTGGG - Intergenic
969337654 4:6521223-6521245 GCAGGTTTGCCTAGGGCACAGGG - Intronic
969478439 4:7434291-7434313 GCAGGTCTCCCGACTCCAGGAGG - Exonic
969535290 4:7752874-7752896 GCAGGCCTCCCATGGGCACATGG - Intergenic
976299163 4:83501684-83501706 GCAGTCCTCCTGAGGGGAGACGG - Intronic
976399111 4:84587658-84587680 GCAAGTCTTCAGAGGGCAGAGGG - Intronic
981010707 4:139922056-139922078 CCAGGTCTGTGGAGGGCAGAGGG + Intronic
981315041 4:143333805-143333827 GCAGGTCACCTGAGGCCAGGAGG - Intergenic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
984450348 4:179892792-179892814 GAAGTTCTCACGAGAGCAGATGG - Intergenic
984454449 4:179946457-179946479 GGAGGTCACCCCATGGCAGAAGG + Intergenic
985709881 5:1422247-1422269 GCAGGGGTGCCAAGGGCAGATGG - Intronic
986101039 5:4611976-4611998 GGAGCTCTCCCCAGAGCAGAGGG - Intergenic
990184607 5:53200115-53200137 GCAGGACTCCCTATGGCTGAGGG + Intergenic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
993501938 5:88674960-88674982 GCAGGGCTGCCGCGGGCGGAAGG + Intergenic
1000662323 5:163951563-163951585 GCAGCTTTCCCGAGGGTACAGGG + Intergenic
1001567821 5:172711909-172711931 GCAGCCCTCCTGAGGGGAGATGG - Intergenic
1002211946 5:177604558-177604580 GCAGGGGTGCCGAGGGGAGAGGG - Intronic
1003406326 6:5829817-5829839 GCCGGCCTCCCGAGGGTACAGGG - Intergenic
1005996752 6:30936208-30936230 GCAGGTCCTAAGAGGGCAGAGGG - Intergenic
1006043307 6:31272020-31272042 CCAGGCCTCCCGAGAGCAGCAGG + Exonic
1006295089 6:33166728-33166750 TCAGGGCTCCCCTGGGCAGAAGG - Exonic
1007485796 6:42179651-42179673 GGGGGTCACCCGACGGCAGAGGG - Exonic
1007908570 6:45489565-45489587 GCAGGTTCCCTGAGGGCTGAGGG - Intronic
1008368603 6:50709545-50709567 GAAGGGGGCCCGAGGGCAGATGG + Intergenic
1010262638 6:73833782-73833804 GCAGGTGTGCCAAGAGCAGAGGG - Intergenic
1010514355 6:76754732-76754754 GCAGGTCACCTGAGGTCAGGAGG + Intergenic
1013231677 6:108166276-108166298 GCTGGTCTCCCAAGGAAAGAAGG - Intronic
1015585040 6:134767630-134767652 GCAGGTCTCCAGAGAGGTGATGG + Intergenic
1019314745 7:379251-379273 GCAGGTCTGGGGAGGGCACAGGG + Intergenic
1019428231 7:987275-987297 GGGGGTCCCCCGGGGGCAGAAGG - Intronic
1019896789 7:3989306-3989328 GCAAGTCTCACGAGGTCTGAGGG - Intronic
1023868208 7:44248938-44248960 GCAGGACACCCCAGGGCATATGG - Intronic
1023868221 7:44248973-44248995 GCAGGACACCCCAGGGCACATGG - Intronic
1023978974 7:45054853-45054875 ACAGGGTTCCCCAGGGCAGATGG + Intronic
1027517665 7:79162984-79163006 GCAGGACTCCCTATGGCAGAGGG - Intronic
1032011766 7:128351894-128351916 CCAGGACTCCCGAGGGGCGAAGG + Exonic
1033369723 7:140697085-140697107 GTGCGTCTCCCGAGGGCAGGCGG - Intronic
1034486190 7:151364738-151364760 GCAGATCACCTGAGGTCAGAGGG - Intronic
1037734064 8:21553004-21553026 GGAGGTCTCCACAAGGCAGAAGG + Intergenic
1038540233 8:28385530-28385552 GCGGGTCGCCCGCGGGCGGAGGG + Intronic
1043420039 8:80088582-80088604 GCTGGACTGCCGAGGGGAGAGGG + Intronic
1043459879 8:80448985-80449007 GCAGATCTCCTGAGGTCAGGAGG + Intergenic
1045051768 8:98333910-98333932 CCAGGTCTCCAGTGTGCAGATGG + Intergenic
1045065685 8:98441931-98441953 GCAGGTATCCTGGGGGCAGCTGG - Intronic
1048614669 8:136059902-136059924 GCAGGGTTCCCTTGGGCAGAGGG - Intergenic
1049399432 8:142418312-142418334 CCAGGTCTGCGCAGGGCAGAGGG + Intergenic
1055429392 9:76228228-76228250 GCAGATCACCTGAGGGCAGGAGG - Intronic
1056792586 9:89635673-89635695 GCAGATCACCCGAGGGTGGAAGG + Intergenic
1056967556 9:91177818-91177840 GCAGGCCTGCTGAGGGCACAGGG + Intergenic
1058153456 9:101486685-101486707 GCAGGGGTCCCCAGGGCAGCAGG - Intronic
1060199715 9:121645397-121645419 CCAGGGCTCCTGTGGGCAGAAGG + Intronic
1060967761 9:127721189-127721211 CCAGGTGTCCCCAGGGCAGGGGG + Intronic
1061227415 9:129288769-129288791 GCAGGTCTCAGGAGGCCAGGAGG - Intergenic
1062636797 9:137495770-137495792 GCAGGGCTCCCGCAGGCTGAGGG - Intronic
1185616551 X:1425393-1425415 GCAGCATTCCTGAGGGCAGAGGG + Intronic
1187338668 X:18402340-18402362 GCAGGACTCCAGCGGGCAGAGGG - Intergenic
1191183046 X:57582499-57582521 GCTGGTCTCCTAAGGGCAGCTGG - Intergenic
1191214326 X:57919876-57919898 GCTGGTCTCCTAAGGGCAGCTGG + Intergenic
1200211889 X:154350355-154350377 GCAGACCTCCTGAGGGCCGAAGG + Intronic
1200235079 X:154464240-154464262 GCAGTTCACCGGAGGGCAGCAGG - Exonic