ID: 1089573741

View in Genome Browser
Species Human (GRCh38)
Location 11:119426540-119426562
Sequence CCTCATCAGCAAAGTAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089573730_1089573741 9 Left 1089573730 11:119426508-119426530 CCCACAATAAGGAGGGTGGTTTG No data
Right 1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG No data
1089573728_1089573741 11 Left 1089573728 11:119426506-119426528 CCCCCACAATAAGGAGGGTGGTT No data
Right 1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG No data
1089573729_1089573741 10 Left 1089573729 11:119426507-119426529 CCCCACAATAAGGAGGGTGGTTT No data
Right 1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG No data
1089573731_1089573741 8 Left 1089573731 11:119426509-119426531 CCACAATAAGGAGGGTGGTTTGG No data
Right 1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG No data
1089573725_1089573741 16 Left 1089573725 11:119426501-119426523 CCTGGCCCCCACAATAAGGAGGG No data
Right 1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089573741 Original CRISPR CCTCATCAGCAAAGTAGGGA GGG Intergenic
No off target data available for this crispr