ID: 1089574989

View in Genome Browser
Species Human (GRCh38)
Location 11:119435622-119435644
Sequence ATATCCCCAGGGGAAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089574989_1089574998 -9 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089574998 11:119435636-119435658 TGGGGATATTTGGCCATGTCTGG No data
1089574989_1089575001 16 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575001 11:119435661-119435683 ACATTTTTGGTTGTTGCAATTGG No data
1089574989_1089574999 3 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574989_1089575003 18 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575003 11:119435663-119435685 ATTTTTGGTTGTTGCAATTGGGG No data
1089574989_1089575004 26 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575004 11:119435671-119435693 TTGTTGCAATTGGGGTGAGCTGG No data
1089574989_1089575002 17 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575002 11:119435662-119435684 CATTTTTGGTTGTTGCAATTGGG No data
1089574989_1089575006 28 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575006 11:119435673-119435695 GTTGCAATTGGGGTGAGCTGGGG No data
1089574989_1089575005 27 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089574989 Original CRISPR ATATCCCCAGGGGAAGGGAG GGG (reversed) Intergenic
No off target data available for this crispr