ID: 1089574994

View in Genome Browser
Species Human (GRCh38)
Location 11:119435628-119435650
Sequence GGCCAAATATCCCCAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089574994_1089575006 22 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575006 11:119435673-119435695 GTTGCAATTGGGGTGAGCTGGGG No data
1089574994_1089574999 -3 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574994_1089575005 21 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574994_1089575002 11 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575002 11:119435662-119435684 CATTTTTGGTTGTTGCAATTGGG No data
1089574994_1089575004 20 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575004 11:119435671-119435693 TTGTTGCAATTGGGGTGAGCTGG No data
1089574994_1089575007 26 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575007 11:119435677-119435699 CAATTGGGGTGAGCTGGGGATGG No data
1089574994_1089575001 10 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575001 11:119435661-119435683 ACATTTTTGGTTGTTGCAATTGG No data
1089574994_1089575003 12 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575003 11:119435663-119435685 ATTTTTGGTTGTTGCAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089574994 Original CRISPR GGCCAAATATCCCCAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr