ID: 1089574996

View in Genome Browser
Species Human (GRCh38)
Location 11:119435633-119435655
Sequence GACATGGCCAAATATCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089574996_1089575004 15 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575004 11:119435671-119435693 TTGTTGCAATTGGGGTGAGCTGG No data
1089574996_1089575007 21 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575007 11:119435677-119435699 CAATTGGGGTGAGCTGGGGATGG No data
1089574996_1089574999 -8 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574996_1089575008 27 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575008 11:119435683-119435705 GGGTGAGCTGGGGATGGTATTGG No data
1089574996_1089575001 5 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575001 11:119435661-119435683 ACATTTTTGGTTGTTGCAATTGG No data
1089574996_1089575005 16 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574996_1089575003 7 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575003 11:119435663-119435685 ATTTTTGGTTGTTGCAATTGGGG No data
1089574996_1089575006 17 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575006 11:119435673-119435695 GTTGCAATTGGGGTGAGCTGGGG No data
1089574996_1089575002 6 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575002 11:119435662-119435684 CATTTTTGGTTGTTGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089574996 Original CRISPR GACATGGCCAAATATCCCCA GGG (reversed) Intergenic
No off target data available for this crispr