ID: 1089574997

View in Genome Browser
Species Human (GRCh38)
Location 11:119435634-119435656
Sequence AGACATGGCCAAATATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2410
Summary {0: 4, 1: 39, 2: 288, 3: 719, 4: 1360}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089574997_1089574999 -9 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574997_1089575004 14 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575004 11:119435671-119435693 TTGTTGCAATTGGGGTGAGCTGG No data
1089574997_1089575006 16 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575006 11:119435673-119435695 GTTGCAATTGGGGTGAGCTGGGG No data
1089574997_1089575002 5 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575002 11:119435662-119435684 CATTTTTGGTTGTTGCAATTGGG No data
1089574997_1089575001 4 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575001 11:119435661-119435683 ACATTTTTGGTTGTTGCAATTGG No data
1089574997_1089575003 6 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575003 11:119435663-119435685 ATTTTTGGTTGTTGCAATTGGGG No data
1089574997_1089575005 15 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574997_1089575007 20 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575007 11:119435677-119435699 CAATTGGGGTGAGCTGGGGATGG No data
1089574997_1089575008 26 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575008 11:119435683-119435705 GGGTGAGCTGGGGATGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089574997 Original CRISPR AGACATGGCCAAATATCCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr