ID: 1089574999

View in Genome Browser
Species Human (GRCh38)
Location 11:119435648-119435670
Sequence GCCATGTCTGGAGACATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3406
Summary {0: 17, 1: 279, 2: 697, 3: 1145, 4: 1268}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089574994_1089574999 -3 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574984_1089574999 12 Left 1089574984 11:119435613-119435635 CCCTCTGCTCCCCTCCCTTCCCC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574982_1089574999 16 Left 1089574982 11:119435609-119435631 CCCACCCTCTGCTCCCCTCCCTT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574993_1089574999 -2 Left 1089574993 11:119435627-119435649 CCCTTCCCCTGGGGATATTTGGC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574985_1089574999 11 Left 1089574985 11:119435614-119435636 CCTCTGCTCCCCTCCCTTCCCCT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574989_1089574999 3 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574996_1089574999 -8 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574997_1089574999 -9 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574995_1089574999 -7 Left 1089574995 11:119435632-119435654 CCCCTGGGGATATTTGGCCATGT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574991_1089574999 1 Left 1089574991 11:119435624-119435646 CCTCCCTTCCCCTGGGGATATTT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574983_1089574999 15 Left 1089574983 11:119435610-119435632 CCACCCTCTGCTCCCCTCCCTTC No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268
1089574990_1089574999 2 Left 1089574990 11:119435623-119435645 CCCTCCCTTCCCCTGGGGATATT No data
Right 1089574999 11:119435648-119435670 GCCATGTCTGGAGACATTTTTGG 0: 17
1: 279
2: 697
3: 1145
4: 1268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089574999 Original CRISPR GCCATGTCTGGAGACATTTT TGG Intergenic
Too many off-targets to display for this crispr