ID: 1089575005

View in Genome Browser
Species Human (GRCh38)
Location 11:119435672-119435694
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089574989_1089575005 27 Left 1089574989 11:119435622-119435644 CCCCTCCCTTCCCCTGGGGATAT No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574993_1089575005 22 Left 1089574993 11:119435627-119435649 CCCTTCCCCTGGGGATATTTGGC No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574991_1089575005 25 Left 1089574991 11:119435624-119435646 CCTCCCTTCCCCTGGGGATATTT No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574996_1089575005 16 Left 1089574996 11:119435633-119435655 CCCTGGGGATATTTGGCCATGTC No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089575000_1089575005 0 Left 1089575000 11:119435649-119435671 CCATGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574994_1089575005 21 Left 1089574994 11:119435628-119435650 CCTTCCCCTGGGGATATTTGGCC No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574997_1089575005 15 Left 1089574997 11:119435634-119435656 CCTGGGGATATTTGGCCATGTCT 0: 4
1: 39
2: 288
3: 719
4: 1360
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574990_1089575005 26 Left 1089574990 11:119435623-119435645 CCCTCCCTTCCCCTGGGGATATT No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data
1089574995_1089575005 17 Left 1089574995 11:119435632-119435654 CCCCTGGGGATATTTGGCCATGT No data
Right 1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089575005 Original CRISPR TGTTGCAATTGGGGTGAGCT GGG Intergenic
No off target data available for this crispr