ID: 1089576045

View in Genome Browser
Species Human (GRCh38)
Location 11:119444782-119444804
Sequence GACCTAGAAGCTGAGCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089576045_1089576056 21 Left 1089576045 11:119444782-119444804 CCAGAAGGCTCAGCTTCTAGGTC No data
Right 1089576056 11:119444826-119444848 GGAAGAGTGAAAGAGAGATCTGG No data
1089576045_1089576057 29 Left 1089576045 11:119444782-119444804 CCAGAAGGCTCAGCTTCTAGGTC No data
Right 1089576057 11:119444834-119444856 GAAAGAGAGATCTGGAGCCCAGG No data
1089576045_1089576051 -6 Left 1089576045 11:119444782-119444804 CCAGAAGGCTCAGCTTCTAGGTC No data
Right 1089576051 11:119444799-119444821 TAGGTCCAGGGGGGAATTGAAGG No data
1089576045_1089576053 0 Left 1089576045 11:119444782-119444804 CCAGAAGGCTCAGCTTCTAGGTC No data
Right 1089576053 11:119444805-119444827 CAGGGGGGAATTGAAGGCCCAGG No data
1089576045_1089576058 30 Left 1089576045 11:119444782-119444804 CCAGAAGGCTCAGCTTCTAGGTC No data
Right 1089576058 11:119444835-119444857 AAAGAGAGATCTGGAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089576045 Original CRISPR GACCTAGAAGCTGAGCCTTC TGG (reversed) Intergenic
No off target data available for this crispr