ID: 1089576707

View in Genome Browser
Species Human (GRCh38)
Location 11:119449534-119449556
Sequence GAACACACTAGGTGTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089576707_1089576712 1 Left 1089576707 11:119449534-119449556 CCTCAAGGACACCTAGTGTGTTC No data
Right 1089576712 11:119449558-119449580 CTCAGGGGAAAACAGAAGCCAGG No data
1089576707_1089576714 21 Left 1089576707 11:119449534-119449556 CCTCAAGGACACCTAGTGTGTTC No data
Right 1089576714 11:119449578-119449600 AGGAAGAAAAGTATATTAGTTGG No data
1089576707_1089576715 29 Left 1089576707 11:119449534-119449556 CCTCAAGGACACCTAGTGTGTTC No data
Right 1089576715 11:119449586-119449608 AAGTATATTAGTTGGTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089576707 Original CRISPR GAACACACTAGGTGTCCTTG AGG (reversed) Intergenic
No off target data available for this crispr