ID: 1089582617

View in Genome Browser
Species Human (GRCh38)
Location 11:119490847-119490869
Sequence CCAGAGAGTTCCACCCACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089582617_1089582627 20 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582627 11:119490890-119490912 TGCAGGAGGCTGGATGCTGCGGG No data
1089582617_1089582622 3 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582622 11:119490873-119490895 GCCACTCTCTGGGCTGCTGCAGG No data
1089582617_1089582621 -7 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582621 11:119490863-119490885 TCTCTGGCAGGCCACTCTCTGGG No data
1089582617_1089582624 6 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582624 11:119490876-119490898 ACTCTCTGGGCTGCTGCAGGAGG No data
1089582617_1089582625 10 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582625 11:119490880-119490902 TCTGGGCTGCTGCAGGAGGCTGG No data
1089582617_1089582620 -8 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582620 11:119490862-119490884 CTCTCTGGCAGGCCACTCTCTGG No data
1089582617_1089582626 19 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582626 11:119490889-119490911 CTGCAGGAGGCTGGATGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089582617 Original CRISPR CCAGAGAGTTCCACCCACAC CGG (reversed) Intergenic
No off target data available for this crispr