ID: 1089582622

View in Genome Browser
Species Human (GRCh38)
Location 11:119490873-119490895
Sequence GCCACTCTCTGGGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089582617_1089582622 3 Left 1089582617 11:119490847-119490869 CCGGTGTGGGTGGAACTCTCTGG No data
Right 1089582622 11:119490873-119490895 GCCACTCTCTGGGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089582622 Original CRISPR GCCACTCTCTGGGCTGCTGC AGG Intergenic
No off target data available for this crispr