ID: 1089584395

View in Genome Browser
Species Human (GRCh38)
Location 11:119501207-119501229
Sequence CTGCATTTTGATAGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089584395_1089584399 -5 Left 1089584395 11:119501207-119501229 CCAGCCTTCCTATCAAAATGCAG No data
Right 1089584399 11:119501225-119501247 TGCAGCTCATGCTGGTGCAGTGG No data
1089584395_1089584403 26 Left 1089584395 11:119501207-119501229 CCAGCCTTCCTATCAAAATGCAG No data
Right 1089584403 11:119501256-119501278 TGTAATCCCAGTGCTTTGGGAGG 0: 2259
1: 15138
2: 316847
3: 270289
4: 204792
1089584395_1089584400 22 Left 1089584395 11:119501207-119501229 CCAGCCTTCCTATCAAAATGCAG No data
Right 1089584400 11:119501252-119501274 TGCCTGTAATCCCAGTGCTTTGG 0: 922
1: 6334
2: 107136
3: 248407
4: 305962
1089584395_1089584401 23 Left 1089584395 11:119501207-119501229 CCAGCCTTCCTATCAAAATGCAG No data
Right 1089584401 11:119501253-119501275 GCCTGTAATCCCAGTGCTTTGGG 0: 1440
1: 11399
2: 240726
3: 282028
4: 228085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089584395 Original CRISPR CTGCATTTTGATAGGAAGGC TGG (reversed) Intergenic
No off target data available for this crispr