ID: 1089585246

View in Genome Browser
Species Human (GRCh38)
Location 11:119506374-119506396
Sequence GCAGGTGGAATGGGAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089585235_1089585246 16 Left 1089585235 11:119506335-119506357 CCATCTCCATGTCCAAGGATGGA No data
Right 1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG No data
1089585231_1089585246 27 Left 1089585231 11:119506324-119506346 CCCTAGGAGCACCATCTCCATGT No data
Right 1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG No data
1089585236_1089585246 10 Left 1089585236 11:119506341-119506363 CCATGTCCAAGGATGGAGACCTT No data
Right 1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG No data
1089585232_1089585246 26 Left 1089585232 11:119506325-119506347 CCTAGGAGCACCATCTCCATGTC No data
Right 1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG No data
1089585241_1089585246 -9 Left 1089585241 11:119506360-119506382 CCTTTTCCCTGGCTGCAGGTGGA No data
Right 1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG No data
1089585237_1089585246 4 Left 1089585237 11:119506347-119506369 CCAAGGATGGAGACCTTTTCCCT No data
Right 1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089585246 Original CRISPR GCAGGTGGAATGGGAGTGTG TGG Intergenic
No off target data available for this crispr