ID: 1089590008 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:119533989-119534011 |
Sequence | TGCGGCGCACGCCCGGCTCT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1089590002_1089590008 | 3 | Left | 1089590002 | 11:119533963-119533985 | CCTCAACCTGCTGGCCAGACAGG | No data | ||
Right | 1089590008 | 11:119533989-119534011 | TGCGGCGCACGCCCGGCTCTCGG | No data | ||||
1089590004_1089590008 | -3 | Left | 1089590004 | 11:119533969-119533991 | CCTGCTGGCCAGACAGGCTCTGC | No data | ||
Right | 1089590008 | 11:119533989-119534011 | TGCGGCGCACGCCCGGCTCTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1089590008 | Original CRISPR | TGCGGCGCACGCCCGGCTCT CGG | Intergenic | ||