ID: 1089590008

View in Genome Browser
Species Human (GRCh38)
Location 11:119533989-119534011
Sequence TGCGGCGCACGCCCGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089590002_1089590008 3 Left 1089590002 11:119533963-119533985 CCTCAACCTGCTGGCCAGACAGG No data
Right 1089590008 11:119533989-119534011 TGCGGCGCACGCCCGGCTCTCGG No data
1089590004_1089590008 -3 Left 1089590004 11:119533969-119533991 CCTGCTGGCCAGACAGGCTCTGC No data
Right 1089590008 11:119533989-119534011 TGCGGCGCACGCCCGGCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089590008 Original CRISPR TGCGGCGCACGCCCGGCTCT CGG Intergenic