ID: 1089593726

View in Genome Browser
Species Human (GRCh38)
Location 11:119561343-119561365
Sequence TGGGAACCCTTCCCCCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089593718_1089593726 27 Left 1089593718 11:119561293-119561315 CCAACAGCTGAGCTCTTGAATCT No data
Right 1089593726 11:119561343-119561365 TGGGAACCCTTCCCCCACATGGG No data
1089593723_1089593726 -5 Left 1089593723 11:119561325-119561347 CCTTCAAATTTTCCTTCTTGGGA No data
Right 1089593726 11:119561343-119561365 TGGGAACCCTTCCCCCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089593726 Original CRISPR TGGGAACCCTTCCCCCACAT GGG Intergenic