ID: 1089598184

View in Genome Browser
Species Human (GRCh38)
Location 11:119595752-119595774
Sequence GACCTACCTTGTTAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089598184_1089598186 21 Left 1089598184 11:119595752-119595774 CCTTCAATCTAACAAGGTAGGTC No data
Right 1089598186 11:119595796-119595818 TTTTTTATGCAGAAAGGCAAAGG No data
1089598184_1089598185 15 Left 1089598184 11:119595752-119595774 CCTTCAATCTAACAAGGTAGGTC No data
Right 1089598185 11:119595790-119595812 GCGCAGTTTTTTATGCAGAAAGG No data
1089598184_1089598187 22 Left 1089598184 11:119595752-119595774 CCTTCAATCTAACAAGGTAGGTC No data
Right 1089598187 11:119595797-119595819 TTTTTATGCAGAAAGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089598184 Original CRISPR GACCTACCTTGTTAGATTGA AGG (reversed) Intergenic
No off target data available for this crispr