ID: 1089598185

View in Genome Browser
Species Human (GRCh38)
Location 11:119595790-119595812
Sequence GCGCAGTTTTTTATGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089598184_1089598185 15 Left 1089598184 11:119595752-119595774 CCTTCAATCTAACAAGGTAGGTC No data
Right 1089598185 11:119595790-119595812 GCGCAGTTTTTTATGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089598185 Original CRISPR GCGCAGTTTTTTATGCAGAA AGG Intergenic
No off target data available for this crispr