ID: 1089598753

View in Genome Browser
Species Human (GRCh38)
Location 11:119599925-119599947
Sequence GTGCATGTGAACAGAAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089598751_1089598753 2 Left 1089598751 11:119599900-119599922 CCTGTGTATTAATGTGTGTGCAT No data
Right 1089598753 11:119599925-119599947 GTGCATGTGAACAGAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089598753 Original CRISPR GTGCATGTGAACAGAAGTGT GGG Intergenic
No off target data available for this crispr