ID: 1089599225

View in Genome Browser
Species Human (GRCh38)
Location 11:119603238-119603260
Sequence CAGCTCCGACAGCTCGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 9, 3: 21, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089599221_1089599225 -10 Left 1089599221 11:119603225-119603247 CCTGGGCGGCCTCCAGCTCCGAC 0: 1
1: 0
2: 3
3: 32
4: 296
Right 1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG 0: 1
1: 0
2: 9
3: 21
4: 72
1089599214_1089599225 11 Left 1089599214 11:119603204-119603226 CCATGTCCTGCTTGGCCCGCTCC 0: 1
1: 13
2: 9
3: 45
4: 264
Right 1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG 0: 1
1: 0
2: 9
3: 21
4: 72
1089599219_1089599225 -4 Left 1089599219 11:119603219-119603241 CCCGCTCCTGGGCGGCCTCCAGC 0: 1
1: 2
2: 15
3: 77
4: 474
Right 1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG 0: 1
1: 0
2: 9
3: 21
4: 72
1089599217_1089599225 5 Left 1089599217 11:119603210-119603232 CCTGCTTGGCCCGCTCCTGGGCG 0: 1
1: 1
2: 10
3: 25
4: 166
Right 1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG 0: 1
1: 0
2: 9
3: 21
4: 72
1089599213_1089599225 16 Left 1089599213 11:119603199-119603221 CCGCGCCATGTCCTGCTTGGCCC 0: 6
1: 7
2: 14
3: 32
4: 182
Right 1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG 0: 1
1: 0
2: 9
3: 21
4: 72
1089599220_1089599225 -5 Left 1089599220 11:119603220-119603242 CCGCTCCTGGGCGGCCTCCAGCT 0: 1
1: 2
2: 18
3: 52
4: 282
Right 1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG 0: 1
1: 0
2: 9
3: 21
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089599225 Original CRISPR CAGCTCCGACAGCTCGGCGT TGG Intergenic
900245366 1:1633877-1633899 CAGCCCCCACAGCTCGTCCTGGG - Exonic
900256597 1:1701036-1701058 CAGCCCCCACAGCTCGTCCTGGG - Intronic
900299778 1:1970760-1970782 CTGCTCCGCCAGCTCTGCCTTGG + Exonic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915559290 1:156677076-156677098 CAGGGCCGCCAGCTCGTCGTCGG + Exonic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
921138862 1:212286143-212286165 CAGCGCCGCCATCTCGGCCTCGG + Exonic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1062886383 10:1019655-1019677 CAGCTCCCACAGCTCCTCCTGGG + Exonic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1074756492 10:116627721-116627743 CAGGTCCCACAGCACCGCGTGGG - Intronic
1076852870 10:133101634-133101656 CAGCCCCCACAGCCCGGCCTCGG - Intronic
1077024527 11:433337-433359 CGGCGCGGCCAGCTCGGCGTGGG + Exonic
1077038407 11:506616-506638 CGGCTCCCACAGCCGGGCGTTGG - Intronic
1077108317 11:851336-851358 CAGCTCCTGCAGCTGGGAGTCGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1081965724 11:47168221-47168243 CATCTCAGACAGCACGGAGTGGG + Exonic
1084672636 11:70616312-70616334 CAGTTCCGACAGCCCAGTGTGGG - Intronic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130207651 15:81892532-81892554 CAGCTCCCACAGGTCAGTGTGGG - Intergenic
1132419127 15:101650328-101650350 CAGGTCCCACAGCTGGCCGTGGG - Intronic
1133708140 16:8375293-8375315 CAGCTCCGAGAGGTGGGAGTAGG + Intergenic
1138461004 16:57147570-57147592 CAGCTCCGCCAGCACAGCTTTGG - Exonic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1142567899 17:852560-852582 CAGCTCCCAGAGCTCCGAGTTGG + Intronic
1148440226 17:47708411-47708433 CTCCTCCGTCAGCTCGGTGTAGG - Exonic
1152726381 17:81948800-81948822 CAGCTCCCACAGCACGGCAGGGG + Intergenic
1152841313 17:82570521-82570543 CAGCGCTGACAGCTCAGAGTGGG - Intronic
1154274692 18:12948495-12948517 CAGCCCCGGCAGCGCGGCCTGGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1160017910 18:75158268-75158290 CAGCTCCCACTGCTCTGAGTTGG + Intergenic
1162798734 19:13099634-13099656 CAGCTTCCTCAGCTCGGCGAAGG + Exonic
931252878 2:60549683-60549705 CAGCTCGGCCAGCTCGGCCGCGG + Intronic
934755917 2:96824793-96824815 CAGCTCTGCCAGCTCTGCCTGGG + Intronic
936057527 2:109272109-109272131 CAGCTCCGACAGCTGGCCAGAGG - Intronic
937411944 2:121684283-121684305 CAGCCCCGCCAGCTGGCCGTAGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944420739 2:199527271-199527293 CAGCTCAGACAGGTCGATGTTGG - Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1175872790 20:62216407-62216429 CAGCTCCGGCAGCTCCTCGAGGG - Exonic
1178914157 21:36697785-36697807 CTGCTCCGAAAACTCGCCGTCGG - Intergenic
1181167565 22:20991814-20991836 CAGCTCCGACAGCGAGGTGAGGG + Exonic
1182441371 22:30366215-30366237 CAGCTCCAGCAGCACGGCATGGG - Exonic
1183299519 22:37051999-37052021 CAGGCCCGACAGCCCCGCGTCGG - Intronic
1183613573 22:38927507-38927529 CCTCTCCGACAGCTCGGCCAGGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952754592 3:36855372-36855394 CAGCAGCGCCAGCTCGGCCTGGG + Exonic
955140125 3:56260520-56260542 CACCTCCCACAGCTCTGGGTGGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957529851 3:81427138-81427160 GAACTCCGACAGCTCAGCCTAGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
965882047 3:173397798-173397820 CAGCTCCGCGCGCTCGGCGCTGG - Intronic
968359368 3:198136720-198136742 CAGCACAGACACCTCGGTGTAGG - Intergenic
968547487 4:1206342-1206364 CAGCCCCTTCAGCTCGGCCTAGG - Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
968650986 4:1760206-1760228 CAGCTCCGGGAGCTCAGGGTAGG + Intergenic
969617642 4:8262818-8262840 CAGCACCCACAGCTGGGCCTGGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1002875396 6:1205061-1205083 CAGCTCCCACAGCCTGGCGAGGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019260627 7:79956-79978 CAGCACAGACACCTCGGTGTAGG + Intergenic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1026857026 7:73761946-73761968 CAGCTCCGCCACCTCCGCTTAGG + Intergenic
1027164992 7:75828021-75828043 CAGCTCTCCCAGGTCGGCGTGGG + Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1041146737 8:54884073-54884095 CAGGTCCGACAGCCCAGGGTGGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1049317360 8:141976424-141976446 CAGCTCCCACAGCCCAGCTTAGG - Intergenic
1053313449 9:37034173-37034195 CAGCTACCCCAGCTCGGCGGGGG - Exonic
1057118100 9:92545165-92545187 GAGCTCCCACAGCACAGCGTGGG - Intronic
1057623243 9:96655162-96655184 CAGCACCGGCAGCTCGGCCACGG + Exonic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1062744055 9:138200434-138200456 CAGCACAGACACCTCGGTGTAGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1190727064 X:53196739-53196761 CAGTTCCTGCAGCTCGGCCTGGG + Exonic
1192340325 X:70258657-70258679 CAGCTCCGTCAGCTCTGTGGTGG - Exonic