ID: 1089602532

View in Genome Browser
Species Human (GRCh38)
Location 11:119624362-119624384
Sequence CTCTAAACACAGCTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 288}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089602516_1089602532 27 Left 1089602516 11:119624312-119624334 CCCGGGTCCGACAGGACAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288
1089602526_1089602532 -10 Left 1089602526 11:119624349-119624371 CCTCTGCTCTGCCCTCTAAACAC 0: 1
1: 0
2: 3
3: 26
4: 346
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288
1089602520_1089602532 20 Left 1089602520 11:119624319-119624341 CCGACAGGACAGGAGGGCCCAGG 0: 2
1: 0
2: 1
3: 41
4: 350
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288
1089602523_1089602532 3 Left 1089602523 11:119624336-119624358 CCCAGGCAGCCGGCCTCTGCTCT 0: 1
1: 1
2: 3
3: 20
4: 315
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288
1089602518_1089602532 26 Left 1089602518 11:119624313-119624335 CCGGGTCCGACAGGACAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288
1089602525_1089602532 -6 Left 1089602525 11:119624345-119624367 CCGGCCTCTGCTCTGCCCTCTAA 0: 1
1: 0
2: 1
3: 59
4: 497
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288
1089602524_1089602532 2 Left 1089602524 11:119624337-119624359 CCAGGCAGCCGGCCTCTGCTCTG 0: 1
1: 0
2: 4
3: 59
4: 440
Right 1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 29
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089602532 Original CRISPR CTCTAAACACAGCTGGGGCC AGG Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900932259 1:5744573-5744595 TTCTAAACTCAGCTCAGGCCTGG - Intergenic
901009733 1:6193301-6193323 TTGTAAAGTCAGCTGGGGCCAGG - Intronic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
904259817 1:29281974-29281996 ATAGAAACACAGCTGGGACCAGG + Intronic
904356436 1:29943100-29943122 CTCTCAACACACCTGGTGTCAGG - Intergenic
905633367 1:39531469-39531491 CTCTGAAAACACCTGGGACCTGG + Intergenic
908175497 1:61551951-61551973 CTGTCAACCCACCTGGGGCCAGG - Intergenic
908248978 1:62250282-62250304 CTTTAATAACAGCTGGGGGCTGG - Intronic
909392271 1:75131719-75131741 CCCTAAAAACAGATGGGGGCAGG - Intronic
909744728 1:79080007-79080029 CACTAAGCTCAGCTGTGGCCTGG + Intergenic
910923921 1:92378772-92378794 CTCTATACCCAGCTTGGGCTTGG + Intronic
911669670 1:100593529-100593551 CTCTGGACACACCTGGGGCCTGG - Intergenic
912242730 1:107927824-107927846 CTCTGGACCCACCTGGGGCCTGG + Intronic
912515265 1:110212836-110212858 CTCTCACCCCAGCTGAGGCCAGG - Intronic
913416788 1:118618191-118618213 CTCTGGACCCACCTGGGGCCTGG - Intergenic
915271580 1:154757534-154757556 ATCTAAACAGAGATGGGCCCTGG + Intronic
915476161 1:156153993-156154015 CCCTGAACCCAGCTGGGGCTGGG + Intronic
916329907 1:163603405-163603427 TTCTAAATAATGCTGGGGCCAGG + Intergenic
919146492 1:193642561-193642583 CTCTAAACACTGCTTTAGCCTGG + Intergenic
920744989 1:208617697-208617719 CTCTGGACCCACCTGGGGCCTGG + Intergenic
920982373 1:210850201-210850223 ATCTAAAAACATCTGGGGCCAGG + Intronic
921929295 1:220742117-220742139 CTCTGAACCCACATGGGGCCTGG - Intergenic
922642335 1:227246356-227246378 CTCTGGACACACCCGGGGCCTGG + Intronic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
923524988 1:234765677-234765699 ATCACCACACAGCTGGGGCCAGG + Intergenic
923902180 1:238338111-238338133 CAATGAACACAGCTGGTGCCTGG - Intergenic
923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG + Intergenic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
1064521650 10:16209321-16209343 CTCTGAACCCACCTGGGGCCTGG - Intergenic
1065420099 10:25533826-25533848 GTTTAAACTCAGCTGGGGTCTGG - Intronic
1066569189 10:36753072-36753094 CTAAAAACACAGTTGAGGCCGGG - Intergenic
1067473648 10:46552791-46552813 CTCTGAACACAGCCCCGGCCTGG + Intronic
1068718622 10:60216876-60216898 CTGTAAATCCATCTGGGGCCTGG + Intronic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1069863035 10:71483101-71483123 ATCACAACTCAGCTGGGGCCTGG + Intronic
1070059310 10:72967176-72967198 CTCTGGACCCATCTGGGGCCTGG - Intergenic
1070467941 10:76743772-76743794 CTATAAAAAAAGCTTGGGCCGGG + Intergenic
1071046626 10:81387172-81387194 CTCTGAACATGCCTGGGGCCTGG - Intergenic
1073248932 10:102110032-102110054 CTCCACACACACCTGGGGACAGG + Exonic
1074123793 10:110512483-110512505 CTCTGAACACAGTTGGGGAAAGG - Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077076269 11:703600-703622 TTGGAAACACAGGTGGGGCCTGG - Intronic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1078643148 11:13114504-13114526 CCTGAAACAGAGCTGGGGCCAGG - Intergenic
1078723445 11:13905294-13905316 CTCTAAGCCTAGCTGGGGCTTGG - Intergenic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1082085793 11:48048496-48048518 CTCTAAACACATTATGGGCCGGG + Intronic
1083876900 11:65529068-65529090 CCCCACACACGGCTGGGGCCGGG - Intronic
1084088013 11:66863594-66863616 CTCTGAAAACAGCTGGAGTCTGG + Intronic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084550649 11:69839783-69839805 TTCAAAACACAGGTTGGGCCAGG + Intergenic
1086414970 11:86579539-86579561 CACTAAACACAGCTGTGACCAGG + Intronic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1090422882 11:126587895-126587917 CTCTAAGGAGAGCTGGGCCCTGG + Intronic
1093123958 12:15306554-15306576 CTCTGGACCCACCTGGGGCCTGG - Intronic
1094713400 12:32987193-32987215 CAGGAAACAAAGCTGGGGCCTGG - Intergenic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1098527406 12:71501599-71501621 CAATAAAAACAGCTGTGGCCTGG - Intronic
1102122072 12:110449778-110449800 CCCTAAACCCAGCTGGCTCCGGG + Intronic
1103398370 12:120625357-120625379 TTCTAAAGACAACAGGGGCCAGG + Intergenic
1103912266 12:124359080-124359102 CTGTAAACTCAGCGGGGCCCCGG + Intronic
1104404810 12:128508532-128508554 CTCTGCACACAGCTGGGGACAGG - Intronic
1104758378 12:131282787-131282809 CCCTCAGCAGAGCTGGGGCCTGG + Intergenic
1105239122 13:18594804-18594826 CCCCAAACAAAGATGGGGCCTGG + Intergenic
1106190843 13:27451013-27451035 GGCAAAACAAAGCTGGGGCCGGG + Intergenic
1107356672 13:39574774-39574796 ATCAAAAAACAGGTGGGGCCAGG + Intronic
1108023027 13:46148323-46148345 CTCCAAACACAACTGGGACCTGG + Intronic
1108143073 13:47446971-47446993 TTCTCAACACAGCAGGTGCCTGG + Intergenic
1112641452 13:101280114-101280136 CTCTAATCACAGCTCCTGCCCGG + Intronic
1113365340 13:109670383-109670405 CCCTAAACAGTGCTGGGGACAGG - Intergenic
1113433298 13:110268723-110268745 CTCTTAACACAACTGGGACAAGG + Intronic
1113544534 13:111138016-111138038 TCAAAAACACAGCTGGGGCCAGG + Intronic
1115627994 14:35214609-35214631 CCCAAAACAAAGCTGGGGCCGGG + Intronic
1116297835 14:43135876-43135898 CTCCACCCACAGCCGGGGCCGGG - Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119801774 14:77451741-77451763 CTCTTAGCAAAGCTGGGGGCAGG - Intronic
1120720806 14:87888182-87888204 ATTTAAACACATCTGGGCCCAGG + Intronic
1121246247 14:92462873-92462895 CCCTAAGCACATCTGGGGTCTGG - Intronic
1121333257 14:93061191-93061213 CTCAACACAGATCTGGGGCCAGG + Intronic
1121738527 14:96235544-96235566 CCCTAAGCACAGCTGGGATCAGG - Intronic
1123508564 15:20971952-20971974 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123565786 15:21545701-21545723 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123602048 15:21982988-21983010 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1126280654 15:46944468-46944490 CTCTAAAGAAAGCTTGGCCCTGG + Intergenic
1128454705 15:67825955-67825977 CTCACCACTCAGCTGGGGCCGGG + Exonic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1131323444 15:91420388-91420410 CTCTAAACACACCCAGGACCAGG - Intergenic
1132048561 15:98587435-98587457 ATATAAAGACAGCTGGGGCCAGG + Intergenic
1132122636 15:99191096-99191118 CTCTAAGCTCAACTGGGACCTGG + Intronic
1132343825 15:101095037-101095059 CTATAAAAACAGCTGGGCCCAGG - Intergenic
1202974155 15_KI270727v1_random:272794-272816 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1132586371 16:707269-707291 CTCTCACCACAGCAGGTGCCAGG + Intronic
1133004627 16:2872314-2872336 ATCAAAACCAAGCTGGGGCCAGG + Intergenic
1134842621 16:17413920-17413942 CCCTAAACCAACCTGGGGCCAGG + Intronic
1138419216 16:56888367-56888389 CACCAAAGCCAGCTGGGGCCAGG + Intronic
1138610300 16:58118182-58118204 TTCAAAACAGGGCTGGGGCCAGG + Intronic
1138638220 16:58361376-58361398 CTCTCAATCCACCTGGGGCCCGG - Intronic
1139655501 16:68384784-68384806 CTCTACACACAGCTAGGGTCAGG - Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1141735893 16:85852989-85853011 ATCTAAACCCAGCTAAGGCCAGG + Intergenic
1141859219 16:86705093-86705115 CTTTAAACCCTGCTGTGGCCAGG + Intergenic
1142009785 16:87708006-87708028 CACTCAACACGGCTGGGTCCTGG + Exonic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142202243 16:88766796-88766818 CTCTGAGAGCAGCTGGGGCCGGG - Intronic
1142311556 16:89317186-89317208 CTCTGATCAGGGCTGGGGCCCGG + Intronic
1144566593 17:16364479-16364501 CTCTAAATACAGCATGGGCAAGG + Intergenic
1144634932 17:16899588-16899610 TAATAAACAGAGCTGGGGCCGGG - Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145168986 17:20638816-20638838 TAATAAACAGAGCTGGGGCCGGG - Intergenic
1145882369 17:28361536-28361558 TTCTAAACACTGCTGGGACTAGG + Exonic
1145882587 17:28363358-28363380 CTCTAATCCCAGCTGAAGCCTGG + Exonic
1146770776 17:35567218-35567240 ATCTAAACACAGTTGAGGCCGGG + Intergenic
1147002442 17:37373539-37373561 CTCTAAAGTCAGCCTGGGCCAGG - Intronic
1147518946 17:41149716-41149738 CTCTGAGCAGAGCTGTGGCCTGG - Exonic
1147589050 17:41669525-41669547 CTCTAGGCCCAGCTGGGGGCTGG + Intergenic
1147614452 17:41819953-41819975 CTCCCAGCACAGCTGGGTCCTGG - Intronic
1148690989 17:49526839-49526861 ATCTAAGCAGAGCTGGGGCAGGG - Intergenic
1149163268 17:53720491-53720513 CAATAAGCACAACTGGGGCCGGG + Intergenic
1149180579 17:53931796-53931818 CTCTGGACTCACCTGGGGCCTGG - Intergenic
1149678118 17:58485246-58485268 CTATAAAGAAATCTGGGGCCGGG - Intronic
1151308505 17:73279283-73279305 CTCTAAAATGAGCAGGGGCCAGG + Intergenic
1151450306 17:74194702-74194724 CCCTCAGCACAGGTGGGGCCTGG - Intergenic
1152157481 17:78644370-78644392 CTCTCCACACAGCTTGGTCCTGG - Intergenic
1153036594 18:768995-769017 ATCTAAACATATCTAGGGCCAGG - Intronic
1153075242 18:1155588-1155610 CTCTAAACCCAACCGGGACCAGG - Intergenic
1153363386 18:4224743-4224765 CTCTGGACCCACCTGGGGCCAGG + Intronic
1154449675 18:14463836-14463858 CCCCAAACAAAGATGGGGCCTGG - Intergenic
1155074003 18:22339399-22339421 CTCTACACACAGCCTGGTCCTGG - Intergenic
1155108448 18:22689893-22689915 CTCTAAACACTGCAGGGAGCAGG + Intergenic
1156398110 18:36717442-36717464 CTCTAATACCTGCTGGGGCCAGG + Intronic
1157291249 18:46411609-46411631 CTCTCGTCACAGCTGGGGACAGG - Intronic
1158488266 18:57887606-57887628 CTCAAAACAGTGCTGGGGCTCGG + Intergenic
1159896420 18:74001249-74001271 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1160513738 18:79467022-79467044 CTGTAAACAGAACTGGGACCGGG - Intronic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1161568419 19:5016467-5016489 GTCTAAGCACAGCTTGCGCCTGG - Intronic
1161732978 19:5973525-5973547 CACTACAGACATCTGGGGCCAGG - Intronic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1162716863 19:12639836-12639858 CCCCCTACACAGCTGGGGCCAGG - Intronic
1163677962 19:18664877-18664899 CTCTAAAATCAGAAGGGGCCCGG - Intronic
1163984215 19:20929731-20929753 ATCTAAACAGAACTGGGGCAGGG - Intronic
1165899231 19:39161079-39161101 CTCTAAACAGTGCTGGGTGCTGG - Intronic
1166053852 19:40277097-40277119 CTTCACACACAGCTGGGGACAGG + Intronic
1168206222 19:54852370-54852392 CCCCAAATACAGTTGGGGCCTGG - Intronic
1168261908 19:55200076-55200098 ATGTAATCACAGCTGGGGGCTGG - Intronic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
928932297 2:36637027-36637049 TTCCAAACACAGCCTGGGCCAGG + Intronic
929190191 2:39132759-39132781 TTCAAAACAAAGCTGGGGCCGGG + Intergenic
929281653 2:40087027-40087049 CTCTAGACACACCTGGGGTGGGG - Intergenic
929373412 2:41254613-41254635 ATCTGAACAAAACTGGGGCCTGG + Intergenic
929797591 2:45072187-45072209 CTCTGAACACCGCTGAGCCCTGG - Intergenic
929958894 2:46481039-46481061 CTCTAAGGAGAGCTGAGGCCGGG + Intronic
930053859 2:47237240-47237262 CTCAAAAATGAGCTGGGGCCGGG + Intergenic
930492431 2:52092801-52092823 CTCTAGATCCACCTGGGGCCTGG - Intergenic
931666764 2:64615372-64615394 GGCTACACAGAGCTGGGGCCAGG - Intergenic
935813030 2:106818115-106818137 CTCAAGACCCACCTGGGGCCAGG + Intronic
935928175 2:108093218-108093240 TTCTGGACACACCTGGGGCCTGG - Intergenic
937366593 2:121266508-121266530 CTCTAAACCAAGCAGGTGCCTGG - Intronic
941227741 2:162869090-162869112 CTCTGGACCCATCTGGGGCCTGG + Intergenic
942342197 2:174960545-174960567 ATTAAAACACAGCTGGGGCCGGG + Intronic
942862864 2:180636589-180636611 CTCTGGACCCATCTGGGGCCTGG + Intergenic
945092979 2:206193381-206193403 AAGAAAACACAGCTGGGGCCAGG - Intronic
946018223 2:216621136-216621158 ATCTCAACCCAGCTGTGGCCGGG - Intergenic
946378204 2:219327067-219327089 CTCAAAAAACAGCAGGGTCCAGG + Intergenic
947486324 2:230552598-230552620 CTCAAAAGACAACTGGGCCCGGG - Intergenic
948174769 2:235934467-235934489 CACTAAACATTGCTGGGGTCTGG - Intronic
948841136 2:240649614-240649636 ATCTTAACACAACAGGGGCCTGG - Intergenic
949048244 2:241882066-241882088 GTTTCAACACAGCTGAGGCCTGG + Intergenic
1169213156 20:3778682-3778704 CTCTGCACACAGCTGGGGTTGGG - Intronic
1169926819 20:10792617-10792639 CTCTCAGCTCAGCTCGGGCCAGG + Intergenic
1170536943 20:17349831-17349853 TTTTAAACACCGCTGAGGCCAGG + Intronic
1170616456 20:17956425-17956447 TTAAAAACAAAGCTGGGGCCCGG + Intronic
1171328173 20:24314255-24314277 CTCTAAAGCCAGGTGGGGCAGGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172520035 20:35560353-35560375 CCCTTCACCCAGCTGGGGCCGGG + Intergenic
1174339071 20:49884723-49884745 CTCTCCCTACAGCTGGGGCCTGG - Intronic
1176446498 21:6826554-6826576 CTCCGAACAAAGATGGGGCCTGG + Intergenic
1176824668 21:13691584-13691606 CTCCGAACAAAGATGGGGCCTGG + Intergenic
1178398521 21:32263776-32263798 CTGCAAACCCAGCTGGGGTCGGG + Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179094073 21:38296461-38296483 CACTTGACACAGCTGGGTCCTGG - Intronic
1180007601 21:45030147-45030169 CTCTAATCACAGATGGTTCCCGG + Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180883310 22:19222060-19222082 CTCCAATCACAGCTGGGGTCCGG + Exonic
1181736791 22:24888470-24888492 GTTAAAAAACAGCTGGGGCCGGG + Intronic
1182633155 22:31703109-31703131 CTTAAAACACAGCAGGGGCCAGG - Intronic
1183960813 22:41410938-41410960 CTCTAAACACAAAGGAGGCCAGG - Intergenic
1184380054 22:44139744-44139766 CTCAAAACACAGGCTGGGCCGGG - Intronic
1184496902 22:44847199-44847221 CTCTGAAGCCAGCAGGGGCCTGG + Intronic
1185006200 22:48278290-48278312 GTCTCAAGACAGCTGCGGCCGGG + Intergenic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
1185392813 22:50571791-50571813 CTCTAAACACAGATGGCCCCAGG + Intronic
949439517 3:4065766-4065788 CTTTAAACTCTGCTGGGACCAGG - Intronic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
952066375 3:29576581-29576603 CTCTGGACCCACCTGGGGCCTGG - Intronic
952222034 3:31332645-31332667 CTCTGGACACAGCCAGGGCCTGG + Intergenic
954838692 3:53493846-53493868 CTCCAAACACACGTGGGGGCGGG + Intergenic
957627926 3:82678796-82678818 CATAAAACATAGCTGGGGCCAGG - Intergenic
959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG + Intergenic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961695628 3:128702293-128702315 CTATAAACAAAGCTGGAGACTGG - Intergenic
962193662 3:133337099-133337121 CTCTGGACCCACCTGGGGCCTGG + Intronic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
964209232 3:154209850-154209872 CTCTCGACCCACCTGGGGCCTGG - Intronic
965016310 3:163161956-163161978 CTTTTAATAGAGCTGGGGCCAGG + Intergenic
966348637 3:179005395-179005417 CTCTGGACCCACCTGGGGCCTGG + Intergenic
966732797 3:183164256-183164278 CTGTAAAACCACCTGGGGCCAGG - Intergenic
967408971 3:189148251-189148273 CTCTAAACTTAGAAGGGGCCAGG + Intronic
969468083 4:7369648-7369670 CACTCAGCAAAGCTGGGGCCAGG - Intronic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972344047 4:38177804-38177826 CTCAGAACACAGCTGCGGCATGG + Intergenic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
975026820 4:69559292-69559314 CTCTGAACATGCCTGGGGCCAGG + Intergenic
975503976 4:75117783-75117805 CTCTTGACCCATCTGGGGCCTGG + Intergenic
975839012 4:78454761-78454783 CTCTTAACACAGCTGGGGTCAGG - Intronic
976254123 4:83083087-83083109 CTCTGGACTCACCTGGGGCCTGG - Intergenic
976908307 4:90267389-90267411 CTCTGGACCCACCTGGGGCCTGG + Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
980657753 4:135811865-135811887 CTCTGAACTCACCCGGGGCCTGG + Intergenic
982174763 4:152695150-152695172 TTCTAAACACTGATGGGGCTGGG + Intronic
983456350 4:167969173-167969195 CTCTGTACCCACCTGGGGCCTGG + Intergenic
985566119 5:618586-618608 CTCCAAGTACAGCAGGGGCCGGG + Intronic
985967486 5:3348735-3348757 CTCTGAACGCAGCTGGCGCGGGG - Intergenic
986190126 5:5488915-5488937 CTCAGAACACTGCTGGGGCCAGG + Intronic
987119841 5:14756676-14756698 CTGCAAACACAGCTGTGGGCTGG + Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
994490343 5:100434928-100434950 CTCTAAATAGAGATGGGGCTGGG - Intergenic
998376721 5:141695720-141695742 CCTTAATCACTGCTGGGGCCTGG - Intergenic
998634075 5:143932687-143932709 CTCTGGACACACTTGGGGCCTGG + Intergenic
998743477 5:145230177-145230199 CACGGAACAAAGCTGGGGCCTGG - Intergenic
999298850 5:150477910-150477932 CTCTAAAGACAGCACTGGCCGGG + Intergenic
999686684 5:154109405-154109427 ATTAAAACACAGCTGTGGCCAGG - Intronic
1001562196 5:172677097-172677119 CTGTAAGCACACCTTGGGCCGGG + Intronic
1001644282 5:173268800-173268822 CTCTAATCACAGCTTGGCCTGGG - Intergenic
1001862086 5:175066071-175066093 TTCCAGACACAGCTGAGGCCAGG - Intergenic
1002602904 5:180364175-180364197 CTCTAAACACTGCCAGGCCCAGG - Intergenic
1003556789 6:7147004-7147026 CTCCAAAAACAGCTGGAGACTGG - Intronic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1007164801 6:39821701-39821723 ATCTGAACATAGCTGGAGCCTGG + Intronic
1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG + Intergenic
1012028682 6:94030163-94030185 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1013707798 6:112859426-112859448 CATTAAACACAGCAGGGCCCTGG + Intergenic
1014073964 6:117215622-117215644 CTCTAAACACACTCTGGGCCAGG - Intergenic
1016589726 6:145730958-145730980 CTCTAAACACAGCAGGGAAAGGG + Intronic
1017380237 6:153820327-153820349 CTCTAAAGACAGCGTGGGGCTGG - Intergenic
1018635569 6:165856243-165856265 TTCTGTACACAGCTGGGACCAGG + Intronic
1018951459 6:168381139-168381161 CTCTGAAGATAGCGGGGGCCAGG - Intergenic
1019469252 7:1209654-1209676 GTCTAAACCCAGGTGGGGACAGG - Intergenic
1021218695 7:17949341-17949363 CTCAAAACCCTGCTGTGGCCGGG + Intergenic
1022432655 7:30341390-30341412 CTCTAAACACTGCTTTGGCTGGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023636838 7:42220472-42220494 CTCTAAACCCAGACAGGGCCAGG + Intronic
1024795419 7:53013793-53013815 CTCTACACAGAGCTGCTGCCAGG - Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1026553739 7:71388820-71388842 CTCTAAAAAAATCTTGGGCCGGG - Intronic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1029306270 7:99622347-99622369 CCCTATTCTCAGCTGGGGCCTGG - Intronic
1029887469 7:103888377-103888399 CTCTTCCCACAGCTGGGGCTTGG + Intronic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030315207 7:108107225-108107247 CTCTGAGCAAAGCTGGTGCCTGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1032403374 7:131638817-131638839 ATCTTATCAGAGCTGGGGCCAGG + Intergenic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1033422641 7:141217271-141217293 CTTTCAGCACAGGTGGGGCCTGG + Intronic
1033867714 7:145713199-145713221 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1034253982 7:149714659-149714681 CTCTACCCGCAGCTGGGGGCGGG + Intergenic
1034347740 7:150397580-150397602 CTCTTACCGCAGCTGGGGCAGGG - Exonic
1035656446 8:1310411-1310433 CTCTAATCATAGCTGGAGGCTGG + Intergenic
1036172983 8:6508152-6508174 TTAAAAAGACAGCTGGGGCCGGG + Intronic
1039548226 8:38424836-38424858 CTCAAAACAGAGCTGGGGAAAGG + Intronic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1042162703 8:65912928-65912950 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1045485837 8:102630434-102630456 TTTTAAAGACATCTGGGGCCAGG + Intergenic
1045590024 8:103582833-103582855 CTCTGGACCCACCTGGGGCCTGG + Intronic
1045733313 8:105266772-105266794 CTCTGAACACACGTGGGGCCTGG - Intronic
1047342709 8:123998659-123998681 CTCTGGACCCATCTGGGGCCAGG - Intronic
1049173319 8:141175485-141175507 TCCTAAACACAGGTGGGGTCTGG - Intronic
1049361715 8:142215236-142215258 CTCCGAACACAGCTGGATCCTGG - Intronic
1050248253 9:3714240-3714262 CTCTGGACACACCTGGGGCCTGG + Intergenic
1051923827 9:22299270-22299292 TTCTACACACACCTTGGGCCAGG - Intergenic
1056230501 9:84538525-84538547 CTCTAGACCCACCTGGAGCCAGG - Intergenic
1056254634 9:84786366-84786388 CCCTACACACAGGTGAGGCCAGG - Intronic
1061918808 9:133770959-133770981 CTCTACACACAGCTTGGGTCTGG - Intronic
1062533681 9:137012445-137012467 CGCTACACACAGCGGGGCCCAGG + Intronic
1203522692 Un_GL000213v1:57977-57999 CTCCGAACAAAGATGGGGCCTGG - Intergenic
1187623539 X:21085711-21085733 TTCTAAACACATCCTGGGCCAGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1190588078 X:51967393-51967415 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1190919488 X:54838882-54838904 CTCTAGACCCACCTAGGGCCTGG - Intergenic
1192380875 X:70614555-70614577 CTCTGGACTCACCTGGGGCCTGG + Intronic
1192725871 X:73751853-73751875 CTCTGGACACATCTGAGGCCTGG - Intergenic
1192957803 X:76092302-76092324 CTCTAAACACTGCTTTAGCCAGG + Intergenic
1193583608 X:83294251-83294273 CTCTAGCCACAGGTGAGGCCTGG + Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1193670358 X:84376794-84376816 CTCTGGACCCACCTGGGGCCTGG + Intronic
1193683659 X:84552289-84552311 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1194687525 X:96940960-96940982 AGGAAAACACAGCTGGGGCCAGG - Intronic
1194791867 X:98160354-98160376 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1195038825 X:100994929-100994951 TTCAAAACACAACTGGGGCTGGG - Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1196495428 X:116318589-116318611 CTCTAGACCTACCTGGGGCCTGG + Intergenic
1196552584 X:117046215-117046237 CTCTGGACACGCCTGGGGCCTGG + Intergenic
1196573362 X:117289177-117289199 CTCTAGACCCATCCGGGGCCTGG + Intergenic
1196865431 X:120066513-120066535 TTCTAGACCCACCTGGGGCCTGG + Intergenic
1196877663 X:120169767-120169789 TTCTAGACCCACCTGGGGCCTGG - Intergenic
1197303003 X:124804080-124804102 CTTTATACTCAGCTGGGGCCAGG - Intronic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1199173667 X:144759230-144759252 CTCTAGACACATGTGGGACCAGG + Intergenic
1199404499 X:147441343-147441365 TTTTAAAGATAGCTGGGGCCAGG - Intergenic
1199835116 X:151582276-151582298 CTCAAAAAAAAGCGGGGGCCAGG - Intronic
1200176880 X:154123238-154123260 CTCTCCACACAGTTGGGGACTGG + Intergenic
1200542492 Y:4477088-4477110 CTCTAGACACAACGGTGGCCTGG - Intergenic