ID: 1089603145

View in Genome Browser
Species Human (GRCh38)
Location 11:119627196-119627218
Sequence GCACTGGGTGGGGTAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089603145_1089603154 11 Left 1089603145 11:119627196-119627218 CCCAAGCCTACCCCACCCAGTGC 0: 1
1: 0
2: 1
3: 17
4: 277
Right 1089603154 11:119627230-119627252 CTCCCATCCCCCACACTCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089603145 Original CRISPR GCACTGGGTGGGGTAGGCTT GGG (reversed) Intronic