ID: 1089608093

View in Genome Browser
Species Human (GRCh38)
Location 11:119653454-119653476
Sequence CCAACCCAGCCCTGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 453}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089608088_1089608093 -8 Left 1089608088 11:119653439-119653461 CCCGGCGCGGGGATCCCAACCCA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453
1089608082_1089608093 9 Left 1089608082 11:119653422-119653444 CCCCTGCAGGAGGGTGGCCCGGC 0: 1
1: 0
2: 0
3: 22
4: 203
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453
1089608075_1089608093 29 Left 1089608075 11:119653402-119653424 CCTGCAGCTGGCCTCAGTGTCCC 0: 1
1: 1
2: 2
3: 55
4: 392
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453
1089608083_1089608093 8 Left 1089608083 11:119653423-119653445 CCCTGCAGGAGGGTGGCCCGGCG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453
1089608084_1089608093 7 Left 1089608084 11:119653424-119653446 CCTGCAGGAGGGTGGCCCGGCGC 0: 1
1: 0
2: 2
3: 19
4: 208
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453
1089608078_1089608093 18 Left 1089608078 11:119653413-119653435 CCTCAGTGTCCCCTGCAGGAGGG 0: 1
1: 0
2: 7
3: 45
4: 495
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453
1089608089_1089608093 -9 Left 1089608089 11:119653440-119653462 CCGGCGCGGGGATCCCAACCCAG 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG 0: 1
1: 0
2: 6
3: 65
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089608093 Original CRISPR CCAACCCAGCCCTGCCCTGA GGG Intronic
900380375 1:2381225-2381247 CCGGCCCAGTCCTGACCTGAGGG + Intronic
900474728 1:2870731-2870753 ATGACCCAGCCCTGCCCAGAAGG + Intergenic
900529993 1:3148414-3148436 CCAGCCCAGCCCAGCCCTGCCGG - Intronic
900561261 1:3308236-3308258 CCAACCCAGTGCTGCCCCGCTGG + Intronic
900680106 1:3911897-3911919 AGAACCCAGCCCTCCCCTCAAGG - Intergenic
900719339 1:4165178-4165200 CCACCCAGGCCCTGCCCTCATGG + Intergenic
900743120 1:4342548-4342570 CCAGCCCAGCCCTCCCCTCTCGG - Intergenic
900951771 1:5862071-5862093 TCCATCCAGCCCTGCCCTGTGGG - Intergenic
901051145 1:6426445-6426467 CCAAGCCTGCCCAGCCCAGAGGG - Intronic
901652076 1:10748801-10748823 CCCACCATGCCCTGCCATGATGG + Intronic
901670857 1:10855732-10855754 GAAACCCAGCCCTGCCCGCAAGG - Intergenic
901866831 1:12111906-12111928 CCAACACAGCCATGCCCAGAGGG + Exonic
902777354 1:18683146-18683168 TCAACCCAGCCCTACTCTGGGGG - Intronic
903325200 1:22565331-22565353 CCCACCCGGCCCTGCTCTGCCGG - Intronic
903374078 1:22854818-22854840 CCAGCCCAGCCCAGCCCAGAGGG + Intronic
903663948 1:24995560-24995582 ACAGTCCAGCTCTGCCCTGAAGG + Intergenic
903825101 1:26138915-26138937 CCAACACAGCCATGCCTTAAGGG + Intergenic
904384981 1:30135199-30135221 TAAACCAAGCCCTTCCCTGAGGG + Intergenic
904425163 1:30418134-30418156 CCAACCCAGCTCTGCCTGGCTGG - Intergenic
905172334 1:36116517-36116539 CCTGCCCTGCCTTGCCCTGAAGG + Intronic
905352313 1:37356309-37356331 CCACCCCCGCCCTGCCCTCAAGG + Intergenic
905747680 1:40433170-40433192 CCAACCCATCCCTGCCTGGCAGG + Intergenic
905849957 1:41266452-41266474 CCAGCCCAGCCCAGCCCAGCAGG - Intergenic
906662197 1:47590816-47590838 CCCACCCTGCCCTGCCCAGCAGG - Intergenic
906914672 1:49995526-49995548 CTAACCCTGCCCTCACCTGAAGG + Intronic
906983867 1:50662052-50662074 CCAACACAGGCCAGCCCTGGGGG - Intronic
907956985 1:59238590-59238612 CCAACACAGCCATGTCCTTAAGG - Intergenic
908078178 1:60543819-60543841 TCAACCTAGCCCAGCCCTGCTGG - Intergenic
910598509 1:89005460-89005482 CTAGCCCCGCCCTGACCTGATGG - Intergenic
911056973 1:93717255-93717277 TGAACCCAGCCCAGCCCAGAAGG + Intronic
911060018 1:93739682-93739704 CGTACTCAGCCCTGCCCTAAGGG + Intronic
911661678 1:100508656-100508678 CCATCTCAGCCCTGGCCCGAGGG + Intronic
912487626 1:110041625-110041647 CCTACCCAGCTCGGCTCTGAAGG - Exonic
913375176 1:118143781-118143803 CCACCCCAGCCCAGACCTGGAGG + Intronic
913480062 1:119279720-119279742 CCAACCCAGACCTGCCCCTATGG - Intergenic
915721642 1:157990246-157990268 GCCACCATGCCCTGCCCTGAGGG - Intergenic
916052768 1:161047950-161047972 CGAACCCAGACCTGTACTGAGGG - Exonic
916518827 1:165544912-165544934 CCAATCAAGCCCTCACCTGAGGG - Exonic
919785147 1:201254040-201254062 CCAGCCCAGCCCAGCCCTGCAGG + Intergenic
919880761 1:201899193-201899215 CCTACCCAGCCCCGCCCTGTTGG + Intronic
920184854 1:204153003-204153025 CCAACAGAGCCCTGCTCAGAAGG - Intergenic
920252364 1:204630292-204630314 CCCACCCGACCCTTCCCTGAGGG - Intronic
920299346 1:204978835-204978857 CCAACCCCAGCCTGCCCTGAGGG - Intronic
920501857 1:206490554-206490576 CCACCCCGGCCCTGCACTGCAGG + Intronic
921180228 1:212626111-212626133 CGAACCCAGGCCAGCGCTGAAGG + Exonic
921933301 1:220773153-220773175 CCCACCCAGCCCTGATCTCAGGG + Intronic
922204839 1:223437183-223437205 CCAACCCACCCCTTCCCAGGAGG + Intergenic
922215467 1:223516390-223516412 CCCACCCTGGCCTGCCCTCATGG + Intergenic
922567223 1:226608680-226608702 CCACCCCAGTCCAGCCATGAGGG + Exonic
922696101 1:227731842-227731864 CCAACCCAGCCCTCCACTCTGGG + Exonic
922744278 1:228035574-228035596 CCATCCCCGCCCTGCCCGGAGGG - Intronic
922767658 1:228164274-228164296 CCAAGCCATCCCTGCCTTGCTGG - Intergenic
922795613 1:228338094-228338116 GACACCCAGCCCTGCCGTGAGGG - Exonic
922821660 1:228488889-228488911 CCAACCCAGCCCAGTACTGAGGG - Intronic
924614553 1:245601850-245601872 CCAACCCAGCCCCGTCCTGCAGG - Intronic
1062948173 10:1476354-1476376 TCAGCCCAGCTCTGCCCTGCAGG - Intronic
1063384578 10:5608026-5608048 CAAACCCCGGCCTGCCGTGAGGG + Intergenic
1063554411 10:7064679-7064701 CAGACCCAGCCCTGACCTTAAGG - Intergenic
1064230689 10:13528170-13528192 CCGCCCCAGCCCTGCCCCGGAGG + Intronic
1065450258 10:25849198-25849220 ACCACATAGCCCTGCCCTGAAGG + Intergenic
1066438991 10:35419498-35419520 GCAACCCAGTCCTTCCCTCATGG - Intronic
1067029193 10:42868934-42868956 CCCACCCAGCCCTGCCCCCTGGG + Intergenic
1067058870 10:43067610-43067632 CCCACCCAGCCCTGCACTCATGG - Intergenic
1067070222 10:43125700-43125722 CCAGCACAGCCCTGCCCTCACGG + Intronic
1067346277 10:45441247-45441269 CCCACCCAGGCCTGCCCTATAGG - Intronic
1068925047 10:62527358-62527380 CTAACCCTGCCCCGACCTGATGG - Intronic
1069785605 10:70986097-70986119 CCAAACCAGTCCCGCCTTGAGGG + Intergenic
1070111967 10:73495636-73495658 CCGACTCAGCCCTGCCCAGCAGG + Intronic
1070151951 10:73810975-73810997 CCCACCCCGCCCAGCCCTGCTGG - Intronic
1070808061 10:79282455-79282477 GCAGCCCCGCCCTGCCCCGAGGG + Intronic
1070840876 10:79487104-79487126 CCACCTCAGGCCTGACCTGATGG - Intergenic
1070967764 10:80539908-80539930 CCAGCGCAGCCCAGCCCGGAAGG - Intronic
1071668052 10:87579316-87579338 GCATCCCAGCCCTGCCGTGTGGG - Intergenic
1072039408 10:91592841-91592863 CTAACCCACCCCTGCCCCCACGG + Intergenic
1072206077 10:93206462-93206484 CCAACCCAGCCCTCCCTAGCAGG + Intergenic
1072727633 10:97824308-97824330 CTAATCCAGCCCTTCCCTCATGG - Intergenic
1074704000 10:116115491-116115513 CCAGCCCTGCCCTGCCCTCCAGG + Intronic
1074831228 10:117250856-117250878 CCACCACAGCTGTGCCCTGATGG + Intronic
1075320137 10:121484966-121484988 CCAACACAGCCTTTCCCTGGTGG - Intronic
1075389913 10:122084600-122084622 CCAATCCTTCCCTGCTCTGAAGG - Exonic
1075616111 10:123891814-123891836 CCAGCCCAGCCCAGCCCCGCGGG - Exonic
1076307499 10:129475317-129475339 CACACACAGCCCTGCCCTGCTGG - Intronic
1076359128 10:129874611-129874633 TCAGCCCAGCTCTGACCTGAAGG + Intronic
1076710745 10:132332420-132332442 CCAACTCAGCCTCGCCCGGATGG + Intronic
1076765612 10:132631347-132631369 GCAGCCCAGCCCAGCCCCGAAGG + Intronic
1076919934 10:133446176-133446198 CCGGGCCAGCCCTGCCCTGGCGG + Intergenic
1077006340 11:359301-359323 CCACCCCAGTCCTGCCATGCTGG - Intergenic
1077226121 11:1439813-1439835 CACACCCTCCCCTGCCCTGAGGG + Intronic
1077458255 11:2693856-2693878 CCCATCCAGGCCTGCTCTGAGGG + Intronic
1078088482 11:8248948-8248970 CCAGCCCAGCTTTGGCCTGAAGG - Intronic
1078354401 11:10623379-10623401 ATACCCCAGCCCTGCCCTGCTGG - Intronic
1079022770 11:16923319-16923341 CCAACCCTGCCCTGAGCTGCTGG - Intronic
1079088195 11:17462051-17462073 CCAACCCAGCCTAGCCATGGGGG - Intronic
1080204446 11:29712878-29712900 CCAGCCCTGCCCTGCCCTGCAGG - Intergenic
1080640669 11:34156474-34156496 CCAACCCTGCCCTTCCCACATGG - Intronic
1081614314 11:44581587-44581609 CCAACCCATCCCTGCCCTCAGGG - Intronic
1081617508 11:44599552-44599574 TCCAGCCAGCCCTGCCCTCAGGG + Intronic
1082825922 11:57578797-57578819 CCAGCCAAGCTCTGCCCTGAGGG - Intergenic
1083666388 11:64277158-64277180 CAAACCCAGCCCTTGCCTGATGG - Intronic
1083999721 11:66289505-66289527 CCAACCAAGCCCTGCCCTTCGGG + Intergenic
1084008819 11:66336592-66336614 CCATGCTAGCCCTGCTCTGAGGG + Intronic
1084271436 11:68031281-68031303 GGAACCCAGCCCTGCCCTGCTGG - Intronic
1084298052 11:68225956-68225978 ACAACCCAGCCTTGCCCAGGAGG + Intergenic
1085226119 11:74922688-74922710 CAAACCCAGTCCTTCTCTGAGGG - Intronic
1085302615 11:75467354-75467376 TCAGGCCATCCCTGCCCTGAGGG - Intronic
1085305900 11:75485982-75486004 CCAGCCCAGCCCTGGGATGATGG + Intronic
1085776108 11:79368125-79368147 CTGACCCAGTCCTGCCCTGGAGG - Intronic
1087222882 11:95565357-95565379 TCAACCCAGTTCTGCCCTGAAGG - Intergenic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1088794458 11:113256080-113256102 CCATCCCACCCCTGCCCCGTGGG - Intronic
1088905851 11:114155205-114155227 CCACGCCTGCCCTGTCCTGAGGG + Intronic
1089249128 11:117144750-117144772 CCTGCCCTGCCCTGCCCTGCCGG + Intronic
1089261276 11:117225562-117225584 CCAGCACAGCCATGCCCTGAAGG + Intronic
1089360736 11:117884733-117884755 CCAACCCAGCTCTCAGCTGAAGG + Intergenic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090452334 11:126817818-126817840 CCAACCCCACCCTGATCTGAAGG + Intronic
1090944696 11:131419592-131419614 CCTACCCAGCCCAGCCACGATGG - Intronic
1091108598 11:132944393-132944415 CCAGCCAAGTCCAGCCCTGACGG + Intronic
1091889352 12:4040781-4040803 CCCACCCACCCCTGCCGTCAAGG - Intergenic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092854481 12:12659742-12659764 CAAACCCATCCAGGCCCTGAAGG - Intergenic
1093005490 12:14046502-14046524 CCAACCCAGTCTGGCCCTGCAGG + Intergenic
1093945865 12:25109156-25109178 ACAACAAAGCCCTGCCCTCAAGG + Intronic
1094447345 12:30546137-30546159 CCAGCCCTGCCCTCACCTGATGG - Intergenic
1096436071 12:51591700-51591722 CCAACTCTGCCCGGCACTGAGGG - Intronic
1100213762 12:92426462-92426484 CCACTCCAGTCCTGCCCAGAGGG - Intronic
1101144856 12:101831047-101831069 CCCTCCCAGCCCAGCCCTCAGGG - Intergenic
1101962041 12:109258041-109258063 CCATCCCAGCCCTCCTCTGATGG + Intronic
1102819377 12:115894964-115894986 CTATCCCAGCCCTGCAATGAAGG + Intergenic
1103413041 12:120726086-120726108 CCGACCCAGCCCGGCCCTTCAGG + Intronic
1103571768 12:121849656-121849678 TCCACCCACCTCTGCCCTGAGGG + Intronic
1104804772 12:131578645-131578667 CCAGCCCAGCCCTCCCGTGCTGG - Intergenic
1105842897 13:24270813-24270835 ACACCCCAGTCCTGCTCTGAAGG + Intronic
1106031470 13:26009395-26009417 CCAGCTCTGCCCTGCACTGAGGG + Intronic
1106401361 13:29434376-29434398 CCAAGACAGCCTTGCCCTGCTGG + Intronic
1107544050 13:41420510-41420532 CCAACCCAGCTCTTGCATGATGG - Intergenic
1107814155 13:44229181-44229203 CCAGCAAAGCCCTGCCCTCATGG - Intergenic
1108662646 13:52600461-52600483 CCAGCCCAGCCCAGCCCAGTCGG + Intergenic
1109073800 13:57806546-57806568 CCAATCCTGCCATGCCCTGTAGG + Intergenic
1110939439 13:81330779-81330801 TCAGCCCCTCCCTGCCCTGAAGG - Intergenic
1111923963 13:94443008-94443030 TAATCCCAGCCCTGCCCTCAAGG + Intronic
1112363873 13:98740761-98740783 CCACCCCACCCCTGTCCTCAGGG - Intronic
1112556966 13:100477955-100477977 AGTACCCAGCCCTGCGCTGACGG + Intronic
1113464002 13:110501479-110501501 CCCCCCCAACCCCGCCCTGAGGG + Intronic
1113496210 13:110731267-110731289 CCTTCCCAGCCCTGCCCAAATGG + Intergenic
1113868753 13:113545631-113545653 CCAGGGCAGCCCTGCCTTGAAGG + Intronic
1113868768 13:113545696-113545718 CCAGGGCAGCCCTGCCTTGAAGG + Intronic
1114454841 14:22847673-22847695 CCGACCCAGCCCCGCCCTGCAGG - Exonic
1114618565 14:24081608-24081630 CGCACCCGGCTCTGCCCTGAGGG + Intronic
1117021370 14:51574142-51574164 CCAGCCCTGCCCAGCCCTTATGG + Intronic
1118138872 14:63057541-63057563 CAGACACAGCCCTGCCCTCATGG + Intronic
1118867910 14:69717865-69717887 CCTGCCCAGCCCTGATCTGAAGG - Intergenic
1119420203 14:74503723-74503745 TCAACCCAGCCCAGCCTGGAAGG + Intronic
1119716549 14:76863621-76863643 CCCACACAGCCCTGCCCTGGAGG - Intronic
1121343129 14:93116471-93116493 CCTACCCTGCCCTGCCCTATGGG + Intergenic
1122205416 14:100145734-100145756 CCAACCCAGCCCTGCCCTCCAGG + Exonic
1122319224 14:100843712-100843734 CCAACCCACCCCTGCCATCTGGG - Intergenic
1122548373 14:102537414-102537436 CCAACACAGCCCTCCCCTTGGGG + Intergenic
1122994380 14:105254951-105254973 CCCACCCTGACCTGCCCTCAAGG - Intronic
1123785097 15:23663579-23663601 TCATCCCAGCCCAGCCTTGAGGG - Intergenic
1124557140 15:30736484-30736506 CCAACCCTGCCCCCACCTGATGG + Intronic
1124560748 15:30771240-30771262 GAACTCCAGCCCTGCCCTGATGG + Intronic
1124670464 15:31634213-31634235 GAAGTCCAGCCCTGCCCTGACGG - Intronic
1124674124 15:31669263-31669285 CCAACCCTGCCCCCACCTGATGG - Intronic
1124848309 15:33311882-33311904 CCACACCAGCCTTGCCCTGTAGG + Intronic
1125502833 15:40250153-40250175 CCAGCTCAGCCCTGCCCAGGAGG - Intronic
1126820334 15:52496849-52496871 CCAACTCAGGACTACCCTGAAGG - Intronic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1128603127 15:69014754-69014776 CCAGCCCAGACGGGCCCTGAAGG + Exonic
1129198246 15:73983637-73983659 CCAGGCCTGCCCTGCCCTGCTGG - Exonic
1129562756 15:76589330-76589352 CTAACCCTGCCCTCACCTGATGG - Intronic
1129684621 15:77677948-77677970 CCAACCCAGCCCTGACCTGTGGG + Intronic
1129858292 15:78840810-78840832 CCAGTCCTGCCCTGCCCTGCTGG + Intronic
1130037952 15:80378592-80378614 CCAAACCTGCTCTTCCCTGATGG - Exonic
1130204252 15:81861456-81861478 CAAACCCAGCCCTGGGCTGGGGG - Intergenic
1130220433 15:82014864-82014886 CCAACCCAGCCCAGCCATAAAGG + Intergenic
1131073400 15:89479834-89479856 AAAACCCAGCCCTGCCCTCCAGG - Intronic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1132423460 15:101693867-101693889 CCTCCCCAGCCCTGACCTCAGGG - Intronic
1132496137 16:264387-264409 CGCACACAGCCATGCCCTGAAGG + Intronic
1132622465 16:874340-874362 CCCACCCCGCCCTGCCCAAAGGG - Intronic
1136237923 16:28925650-28925672 CCGACCCGGCCCTGCCCCGAGGG - Exonic
1136412359 16:30084861-30084883 CCATCCCAGCCCGGCCCAGCCGG - Intronic
1137540756 16:49360083-49360105 CCAACCCTCCGCTGCCCTCAGGG - Intergenic
1138123810 16:54422487-54422509 GCAGGCCAGCCCTGCCCCGATGG - Intergenic
1139248987 16:65476694-65476716 CCCACCCAGCCCTGCGCAGTAGG + Intergenic
1139465351 16:67151115-67151137 CCAGACCAGCCCTTCCCAGAGGG - Exonic
1140649994 16:77077412-77077434 AAACCCCAGCCCTGCCCTGTGGG - Intergenic
1141647709 16:85376401-85376423 TCACCCCAGCCCAGCCCTAATGG - Intergenic
1142134548 16:88445639-88445661 CCCACCCAGCCCTGCCCAAATGG - Intergenic
1142146988 16:88496841-88496863 CCAACTCAGACCTCCCCTGCAGG - Intronic
1142171174 16:88623625-88623647 CAGACCCAGCCCTGTCCTGTGGG + Intronic
1142639813 17:1279425-1279447 CCAGCCCAGCCCAGCCCAGAGGG - Intergenic
1142885960 17:2912218-2912240 CCAGCCCAGCTCTGCCCAGAGGG - Intronic
1142940440 17:3376399-3376421 CTAACCCTGCCTTCCCCTGATGG - Intergenic
1142983194 17:3683171-3683193 CCAACCCTGCCCTGTGCTGTGGG - Intronic
1143108486 17:4541069-4541091 GCCTCCCAGCCCTGCCCTGATGG + Intronic
1143264190 17:5623459-5623481 CCAACACAGCCCTGGACAGATGG - Intergenic
1143445485 17:7006660-7006682 CCTTCCCAGCCCTGCCCTTCTGG + Intronic
1144768411 17:17745681-17745703 CCAACCACACCCAGCCCTGAAGG + Intronic
1144780902 17:17807953-17807975 ACCACCCAGCCCTGCCCTCAGGG + Intronic
1145310695 17:21699735-21699757 GCACCCCAGACCTGCCCAGATGG - Intronic
1145998587 17:29118249-29118271 CTACCCAAGCCTTGCCCTGAGGG - Intronic
1146657878 17:34645670-34645692 CCAGCCCACCCCTCCCCTGGTGG + Intergenic
1147300841 17:39526018-39526040 CCAATCCATCAGTGCCCTGACGG + Exonic
1147595036 17:41711674-41711696 CAAACCCAGCCCAGCACAGAGGG + Intergenic
1147721667 17:42543373-42543395 CCAGCCCAGCTCAGCCATGAGGG - Exonic
1147863756 17:43539704-43539726 CCATCCTAGCCCTTCCCTGCAGG + Intronic
1147900355 17:43779363-43779385 CCGCCCCAGCCCAGCCCTGCTGG + Intergenic
1148674734 17:49438733-49438755 CCACCCCAGCCCTGCTCTTTGGG - Intronic
1148744094 17:49908764-49908786 CCGCCCCAGCCCAGCCCTGGTGG - Intergenic
1148775482 17:50093116-50093138 CAACCCCTGCCCTGCCCTCACGG + Intergenic
1148924343 17:51070011-51070033 CCACCTCAGCCCTCCCGTGAGGG - Intronic
1150620693 17:66805970-66805992 CCAACACAGCCGTGCCCTGCAGG + Exonic
1150806017 17:68319708-68319730 CCTAGCCAGCTCTGCCCTTAAGG + Intronic
1151493063 17:74443987-74444009 CCAACCCAGCTCTGGCCACATGG - Intronic
1151548570 17:74808186-74808208 CCAGCCCAGTCCTGCCCTGAAGG + Intronic
1151565271 17:74893944-74893966 CCACCCCCGCCCCGCCCCGAGGG + Intergenic
1151886666 17:76926739-76926761 CGACCCCACCCCTGCCCTGTGGG - Intronic
1151893756 17:76966631-76966653 AAGACCCAGCCCTGCCCTCAGGG + Intergenic
1152072138 17:78139153-78139175 CCACCCAAGCCTTGTCCTGACGG + Exonic
1152569447 17:81115304-81115326 CCAGCCCAGCCCTGGCATGGGGG - Intronic
1152925009 17:83083177-83083199 CCAACCCACCTCTGCCCAGGAGG - Intronic
1152945431 17:83195238-83195260 CCAGCCCAGCCCAGCCCCGCAGG - Intergenic
1154138282 18:11800305-11800327 CCAATCCACCCCTGCAGTGAGGG + Intronic
1155160194 18:23189487-23189509 CTAACCCAGCCAGGCCCTCATGG + Intronic
1155886735 18:31217442-31217464 CTAACCCTGCCCTCACCTGATGG + Intergenic
1156463083 18:37332568-37332590 CCAACCCAGCCCTGCCCCTTAGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157515602 18:48308945-48308967 CCAGCCCAGCCTCACCCTGAGGG - Intronic
1157752663 18:50193570-50193592 CCTACCCAGCCCAGACCTGTTGG + Intronic
1159766902 18:72502522-72502544 TCAAGCCTGCCCTGGCCTGAAGG + Intergenic
1159952611 18:74496289-74496311 CCAACCCCGCCTTGTCCGGAGGG - Exonic
1160586172 18:79914799-79914821 CAGACTCAGCCCTGCCCAGAGGG + Intronic
1160658852 19:289020-289042 CAGACCCAGCCCTGGCCTCAGGG + Intronic
1160738960 19:677223-677245 CCACCCCAGCCCTGCGCCAAAGG + Intronic
1160980164 19:1812922-1812944 CCAACCCCGCCCTGCGGTGCAGG - Intergenic
1160992511 19:1865495-1865517 ACCAACCAGCCCTGCCCTCAAGG + Intergenic
1161032161 19:2062495-2062517 CCAGCCTATCCATGCCCTGAGGG - Intergenic
1161126401 19:2560450-2560472 CCCACCCAGCCCTTCCCTTGAGG + Intronic
1162003515 19:7763305-7763327 CCAACCCAGCCTTACCCAGGAGG - Exonic
1162152463 19:8655983-8656005 CCATCCAAGCCCTGCTCTCAGGG + Intergenic
1162490188 19:10986982-10987004 CCTCCCAAGCCCTGGCCTGAAGG + Exonic
1163105476 19:15120642-15120664 CCTGCCCAGCCCTCCCCTCAGGG + Intronic
1163169006 19:15517807-15517829 CAACCCCAGCTCTGCCCTGATGG - Intronic
1163476375 19:17528484-17528506 CAGACCCAGCCAGGCCCTGAGGG + Intronic
1163561740 19:18023384-18023406 CAAACCCGGTCCTGCCCTTAGGG - Intergenic
1163886649 19:19971356-19971378 CCAACCCTGCCCTCACCTGATGG - Intergenic
1163938909 19:20475289-20475311 CCAACCCAGCCCTCACCAAAAGG - Intergenic
1163950150 19:20576640-20576662 CTAACCCTGCCCTCACCTGATGG - Intronic
1164643690 19:29843719-29843741 CCAGGCCAGGCCGGCCCTGAGGG + Intergenic
1164784253 19:30917199-30917221 CCCACCCACCCCTTCTCTGATGG - Intergenic
1165074653 19:33273966-33273988 CCAGCCCAGCCAGGCTCTGAGGG + Intergenic
1165335962 19:35169783-35169805 CCAACCCTGCCCGCCCCTGAAGG + Exonic
1165900550 19:39167443-39167465 CCAGCCCAGCCCACCCCTGGTGG - Intronic
1165918647 19:39277775-39277797 CTTCCCCAGCCCTGCCCTGGCGG + Intergenic
1166108083 19:40607320-40607342 CATTCCCAGCCCCGCCCTGAAGG + Intronic
1166852357 19:45766832-45766854 CCACCGCAGCCCAGCCCTCAGGG - Exonic
1166944270 19:46387516-46387538 GCAACCCAGCCCTGCCTCGGAGG + Intronic
1166960181 19:46492440-46492462 AAACCCCAGCCCTGCCCTGGAGG - Exonic
1167301693 19:48681444-48681466 CGAAGCCATCCCTGCCCTGAAGG + Intergenic
1167374499 19:49103678-49103700 CCCACCCAGCCCTGGCCTAGGGG - Intronic
1167725913 19:51212390-51212412 CCACCCCTGCCCTGAGCTGAAGG - Intergenic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168349624 19:55668630-55668652 CCACCTCATCCCAGCCCTGATGG + Intronic
925192293 2:1894251-1894273 CCCACCCCGCCCTGCACTGCTGG - Intronic
925449600 2:3957237-3957259 ATGTCCCAGCCCTGCCCTGAGGG - Intergenic
925794725 2:7529502-7529524 GAAATCCATCCCTGCCCTGAAGG + Intergenic
925919711 2:8630654-8630676 CCCACCCGGCTCTGCCCTGGTGG + Intergenic
926220920 2:10934940-10934962 CCCAGCCAGCCCTGCCCTCAGGG - Intergenic
926268076 2:11344334-11344356 CCAGCCCGGCCCGGCCCTGCCGG + Exonic
927704523 2:25288919-25288941 CTGGCCCAGCCTTGCCCTGAAGG + Intronic
928406565 2:31019547-31019569 ACAACCCAGTCCTGCACTCAAGG + Intronic
929584586 2:43105802-43105824 CATGCCCAGCCATGCCCTGAAGG - Intergenic
929798925 2:45082871-45082893 AGAGCCCAGCCCTGCCCTGAGGG + Intergenic
930031269 2:47059430-47059452 AGAAACCACCCCTGCCCTGATGG - Intronic
931993028 2:67809849-67809871 CTAGCCCTGCCCTGACCTGATGG + Intergenic
932219170 2:69986933-69986955 CCACCCCAGCCTTGCCTTGTGGG + Intergenic
932346584 2:70999680-70999702 CAAACCCAGGCCTTGCCTGAAGG + Intergenic
932568547 2:72924577-72924599 CCGCCCCAGCCCAGCCCTGCTGG + Intronic
933774968 2:85766341-85766363 CACACCCAGCCCGGGCCTGAGGG + Intronic
934689181 2:96345287-96345309 CCAGCCAAGCCCTTCCCTGGAGG - Intronic
934759832 2:96848381-96848403 GCAACACAGCCCAGCCCTGAAGG - Exonic
937153296 2:119700911-119700933 CCAGCACAGGCCTGGCCTGAGGG - Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
937291875 2:120786818-120786840 CCAACCCAGCCCTCCCTTAAAGG + Intronic
938793767 2:134701465-134701487 CCTCCCCAGCTCTGCCCAGAAGG + Intronic
939748699 2:146012518-146012540 CCACCCCAGCCATGCCCTGTTGG - Intergenic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
939944224 2:148389318-148389340 CCAACCCAACCCAGCATTGATGG + Intronic
940384711 2:153057579-153057601 CCAAACCTGCCCTCACCTGATGG - Intergenic
940694320 2:156959640-156959662 GCAGCCCAGCCCTGGCCTGCTGG - Intergenic
942082181 2:172410715-172410737 CCAAGCCATTCCTGCTCTGACGG + Intergenic
945170483 2:206989830-206989852 ACCACCCACCCCTGCCCTAATGG - Intergenic
945251707 2:207769968-207769990 CCAACCGCGCCCGGGCCTGAGGG - Intergenic
945536637 2:211026059-211026081 CCAACCCTGCCCTCACCTGATGG - Intergenic
945783377 2:214204206-214204228 CTAACCCTGCCCTCACCTGATGG + Intronic
946174389 2:217913560-217913582 CCAGCTCAGCCCTCCCCTGGCGG + Intronic
946409840 2:219510491-219510513 CCATCCCAGCCCTCCCCCGCAGG + Intergenic
947023560 2:225711352-225711374 CCTAACCAGCCCCACCCTGAGGG - Intergenic
947527801 2:230889959-230889981 CCATCCCAGACCTGCCCACATGG + Intergenic
947612624 2:231533225-231533247 CCTACCCAGCTCTGCTCTGTGGG + Intergenic
948081307 2:235207431-235207453 CACACCCAGCCCTGCCTTCATGG + Intergenic
948449660 2:238061151-238061173 GCTCCCCAGCCCTGCCCTAAAGG - Intronic
948462832 2:238138652-238138674 CCAGCCCTGCCCCGCCCTGCAGG + Intergenic
948469075 2:238165890-238165912 CAAACACAGCCCTTCCCCGAGGG + Intronic
948514970 2:238498170-238498192 CCCTCCGAGCCCTGCCCTCAGGG + Intergenic
948662671 2:239516647-239516669 CCAACTCAGCCCAGCCCTGGGGG - Intergenic
948911870 2:241008964-241008986 CCAACCCACCCCAGAGCTGATGG - Intronic
949063840 2:241977171-241977193 CTTCCCCAGCCCTCCCCTGAAGG - Intergenic
1169211281 20:3767534-3767556 CCACCCCAGCCCTGCCATCACGG + Intronic
1170590207 20:17765809-17765831 ACCACCCAGCCCTGCCCCCAGGG - Intergenic
1171315889 20:24194392-24194414 CCAACCCAGGCAGGCCCTGAAGG + Intergenic
1171783756 20:29444875-29444897 CCAGCCCAGACCTGCCCTCCAGG + Intergenic
1172275625 20:33677381-33677403 CCAGCCCAGCCCAGCCCAGTTGG + Intronic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1173000549 20:39102367-39102389 CCAGCCCATCCCAGGCCTGAAGG - Intergenic
1173745476 20:45433535-45433557 CCAGCCCAGCCCAGCCCAGCTGG + Intergenic
1174173051 20:48628889-48628911 CAGATCCAGCCCTGCCCTGAGGG + Intronic
1174463545 20:50699773-50699795 CTCACCCAGTTCTGCCCTGATGG - Intergenic
1175301644 20:57947332-57947354 CCACCCCACCCCTGCCATGAAGG - Intergenic
1175389194 20:58615659-58615681 GCAGCCCAGCCCTGGCCTGTTGG - Intergenic
1175612806 20:60365439-60365461 CCAGCCCCTCCCTGCCCTGCAGG + Intergenic
1175736563 20:61391296-61391318 CGGACCCAGCCCAGCCCCGACGG - Intronic
1175852126 20:62099288-62099310 TCAACCCAGCCCTTCCGTGGGGG + Intergenic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1176023197 20:62973000-62973022 GCAGCCCGGCCCTGCCCTGCTGG - Intergenic
1176044492 20:63085336-63085358 CCAACCCAGCCCTCGCCTGCAGG + Intergenic
1176101201 20:63365324-63365346 CAAGCCCAGACCTGCCCTCAAGG - Intronic
1176131854 20:63499579-63499601 CCAACGAAGCCCGGCTCTGAGGG + Intergenic
1178157382 21:29871055-29871077 GCAATCCTGCCCAGCCCTGAAGG - Intronic
1179029043 21:37703959-37703981 CCAGCCCCGCCTTGCCCTGCTGG + Intronic
1179349611 21:40595542-40595564 CCAGCCAAGCTCTGCCCTGAAGG + Intronic
1179881600 21:44295382-44295404 CAGACCCAGCCCTGCCCTTGGGG + Intronic
1180833827 22:18919905-18919927 CCCTCCCAGCCCTGCACAGACGG - Intronic
1181104446 22:20565536-20565558 CCAACCAAGACCTGCTGTGAGGG - Intronic
1181182104 22:21075583-21075605 CCCAACCAGCTCTGCCCAGATGG - Intergenic
1181748578 22:24973167-24973189 CAAACCGAGTCCTGCCATGAAGG - Intronic
1182008647 22:26982159-26982181 CAGACACAGCCCTGCCCTCATGG + Intergenic
1182556490 22:31131952-31131974 ACAACTCAGTCCTTCCCTGAGGG + Intronic
1183281103 22:36933162-36933184 TCAACCCCTCCCTGCCCAGAGGG - Intronic
1183411480 22:37657493-37657515 GCCACCGAGCCCGGCCCTGAAGG + Intronic
1184405393 22:44297975-44297997 CCAGCCCAGCCCAGCCCAGCTGG - Intronic
1184646068 22:45896130-45896152 TCCACCCAACGCTGCCCTGACGG - Intergenic
1184661224 22:45966431-45966453 CCAACCCTTCCGTGCCCTGTTGG - Intronic
1184790693 22:46698026-46698048 CCCACCCAGACCTGCCGTGTTGG + Intronic
1184962985 22:47945078-47945100 CCTGCCCCGCCCTCCCCTGAGGG - Intergenic
1185015161 22:48338718-48338740 CCTCACCATCCCTGCCCTGACGG - Intergenic
1203283913 22_KI270734v1_random:145203-145225 CCCTCCCAGCCCTGCACAGACGG - Intergenic
950202503 3:11055176-11055198 CTTACCCAGCCCTGCTCTCAAGG - Intergenic
950451141 3:13066569-13066591 CCTGCCCAGCCCTGCCTGGAAGG - Intronic
950454069 3:13082375-13082397 CCTCCCCAGCCCTGACCTGAGGG - Intergenic
950540531 3:13609660-13609682 CCCACCCCACCCTGCCTTGAAGG - Intronic
951158768 3:19389513-19389535 GGAATTCAGCCCTGCCCTGAAGG - Intronic
951691011 3:25396647-25396669 CTAACCCTGCCCTAACCTGATGG - Intronic
952878232 3:37966031-37966053 GCAACCGACCCCTGCTCTGAAGG - Intronic
952993610 3:38855401-38855423 CTAACCCTGCCCTCACCTGATGG + Intronic
953017187 3:39088705-39088727 CCAGTCCAGCCCTTCCCTGAAGG - Intronic
953409669 3:42683557-42683579 CCAGCCCAGCCCTGGACTGCAGG - Intergenic
954002082 3:47565810-47565832 CCAACACTGGGCTGCCCTGATGG - Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954616379 3:51970794-51970816 CCATACCATCCCTGGCCTGAGGG + Intronic
954673156 3:52301340-52301362 CCATCCCTGCCCTGTCCTCACGG - Intergenic
954704697 3:52473228-52473250 CCGACCCAGCCCTGCCAAGCAGG + Intronic
954713840 3:52517453-52517475 CCTCCCCGGGCCTGCCCTGAAGG - Intronic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
954799470 3:53178855-53178877 CTAACCTGGCCCTGCCCTCATGG + Intronic
954930371 3:54276098-54276120 CCAACCCATCCCTGCAGGGAGGG - Intronic
956830047 3:73037991-73038013 CCAACTCAGCCCTAACATGAAGG - Intronic
956840430 3:73134888-73134910 ACAACTCAGCCCTGCCGTGGTGG + Intergenic
958510190 3:95037795-95037817 CCAACCCTGCCCCCACCTGATGG - Intergenic
958647096 3:96887704-96887726 CTAGCCCCGCCCTGACCTGATGG - Intronic
958963648 3:100534878-100534900 TCAGCCCAGTCCTGCCCTCAAGG - Intronic
960577964 3:119245746-119245768 CCAACCCTGCCCCGACCTGATGG + Intergenic
960992664 3:123322043-123322065 CCATCCCAGCCCTGGGCTGGAGG + Intronic
961007506 3:123414842-123414864 GCCACCCTGCCCGGCCCTGATGG + Intronic
961034834 3:123635018-123635040 CCCACCCAGCCCAGCCATCAGGG - Intronic
961346197 3:126264996-126265018 CCCACCCAGCCGTGCTCTGGGGG + Intergenic
961362283 3:126375723-126375745 CCTACCCTGCCCTGCCCTGAGGG + Intergenic
961819481 3:129567933-129567955 CCACCCCAACCCTGCCCAGGAGG - Intronic
963119565 3:141764683-141764705 CCAGCCCAGCCCTCTCCTGTGGG + Intergenic
963513763 3:146281843-146281865 CAAAGCCAGCCCTGTCCAGAAGG - Intergenic
965223547 3:165958694-165958716 CCAAGCCAGCCATACCTTGAAGG - Intergenic
966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG + Intronic
966869743 3:184282586-184282608 CAAACCCAGCCCTGCTTTCATGG + Intronic
968449146 4:666996-667018 CCGACCCAGCCCCGCCTCGAGGG - Intronic
968456418 4:702847-702869 CCAAACCCGCCCTGTCCTGCTGG - Intergenic
968469697 4:773756-773778 CGAGCCCTGCCCTGCCCTGCAGG - Intergenic
968562901 4:1294461-1294483 CCAACCTAGCCCAGCCATTACGG - Intronic
968570642 4:1338659-1338681 CCCACACAGCCCTGTCCCGATGG - Intronic
968570661 4:1338718-1338740 CCCACACAGCCCTGTCCCGATGG - Intronic
968570680 4:1338776-1338798 CCCACACAGCCCTGTCCCGATGG - Intronic
968648076 4:1749683-1749705 CCTACCCAACCCTGCCCAGCTGG + Intergenic
968658693 4:1789820-1789842 CCGGCCCAGCCCAGCCCTGGCGG - Intergenic
968762607 4:2450428-2450450 CCAGCCCGGGCCTGCCCTCATGG - Intronic
969169547 4:5348859-5348881 CCAACCCAGTCCACCACTGATGG + Intronic
969428345 4:7138774-7138796 ATGACCCAGCCCTGCCCTCAAGG - Intergenic
969498498 4:7539746-7539768 CCACCCCATCCCTGCTGTGAGGG + Intronic
969575413 4:8033623-8033645 CCAACCCAGGTCTCCCCAGAGGG + Intronic
969586428 4:8096885-8096907 GCAGCCCACCCCTGCCCTCACGG + Intronic
969618217 4:8265808-8265830 TCCACCCAGCCCTGCCAGGAGGG - Intergenic
970051723 4:11922093-11922115 CCAACACAGGACAGCCCTGAAGG + Intergenic
976562777 4:86521412-86521434 CTAACCCTGCCCTGACCTGATGG - Intronic
983237035 4:165191291-165191313 AAAACACAGCTCTGCCCTGAAGG - Intronic
983845584 4:172514216-172514238 CTAACCCTGCCCTCACCTGATGG - Intronic
985520537 5:372175-372197 CCAGCCCACCCCAGCCCTGGGGG - Intronic
985557799 5:565868-565890 CCAACCCAGCCCGGGGCTGCTGG - Intergenic
985767504 5:1787636-1787658 CCCACACAGCCCTGCCCTCCCGG - Intergenic
989727474 5:44603959-44603981 CCAACCCTGCCCCCACCTGATGG + Intergenic
992217326 5:74538881-74538903 TCAACTCATCCCTGCCCTCAAGG + Intergenic
996080821 5:119256078-119256100 CTAACCCTGCCCTTACCTGATGG + Intergenic
997241603 5:132312089-132312111 CAACCCCAGCCCAGCTCTGAGGG - Intronic
997243770 5:132328629-132328651 ACACCCCAGCACAGCCCTGAAGG - Intronic
998480549 5:142459315-142459337 CCAGGCCATCCCTGGCCTGAAGG + Intergenic
999818520 5:155201053-155201075 CTAGCCCTGCCCTGACCTGATGG + Intergenic
1000213983 5:159137443-159137465 CCAACCCACCCATGACCTCATGG + Intergenic
1000433994 5:161185523-161185545 AAACCCCAGCCCTGCCCTGTGGG + Intergenic
1001308479 5:170593708-170593730 CCAGCCCCGCCCTGCCCAGCCGG - Intronic
1001527390 5:172438372-172438394 CAAACCCGGCCCTGCCCCAAGGG - Intronic
1001687114 5:173601987-173602009 CCACCCCAGCCCTGCACTCCAGG - Intergenic
1002080305 5:176733578-176733600 CCATCCCTGCCCAGCTCTGAGGG + Intergenic
1002319427 5:178366151-178366173 CAGACCCAGCCCTGCCCTTGGGG - Intronic
1002527709 5:179824097-179824119 CCACCCCAGGCCTGCACAGAGGG - Intronic
1003078209 6:3000407-3000429 GCTGCCCAGCGCTGCCCTGAAGG + Intronic
1004126935 6:12883135-12883157 CCACCCCAGCCCCTGCCTGAGGG + Intronic
1006419573 6:33924800-33924822 CCAACCCAGTCCTCCCCAGAGGG + Intergenic
1006503041 6:34470035-34470057 CCAGCCCAGCCCTCCCCTCCAGG - Intronic
1006650229 6:35545208-35545230 GCCACCCTGCCCTGCCCTGCGGG - Intergenic
1006698299 6:35950864-35950886 CCAACCCAGCACAGACCTCAAGG - Intronic
1007704852 6:43784346-43784368 CAGCCCCAGCCCTGCCCTCAGGG - Intronic
1008095586 6:47336353-47336375 CCAAGCAAACCCTGCCTTGAGGG + Intergenic
1012203792 6:96436866-96436888 CTAACCCAGCCCCCACCTGATGG + Intergenic
1013241287 6:108248176-108248198 GGAACCCAGGTCTGCCCTGAGGG - Intronic
1014654406 6:124081980-124082002 TCAATCCACCCCTGCCCTTAAGG + Intronic
1016017914 6:139204990-139205012 CTAACCCTGCCCTCACCTGATGG + Intergenic
1017025947 6:150180717-150180739 CCACCCCAGCCATGCTCTTAGGG - Intronic
1019074635 6:169377681-169377703 GCACCCCAACCCTGACCTGAAGG + Intergenic
1019161127 6:170067438-170067460 CCATCCCAGGGCTGTCCTGAAGG - Intergenic
1019277147 7:181801-181823 CCAAAGCAGCCCCGTCCTGACGG - Intergenic
1019648239 7:2142338-2142360 CCAACCCAGCCCTGCACCAGGGG - Intronic
1019666257 7:2253617-2253639 CCCAGCCTGCCCTGCCCTGTGGG - Exonic
1021848563 7:24786011-24786033 CAGACACAGCCCTGCCCTCACGG - Intergenic
1022339488 7:29455059-29455081 CCTGCCTACCCCTGCCCTGAAGG - Intronic
1022505409 7:30906283-30906305 TTTCCCCAGCCCTGCCCTGAGGG - Intergenic
1022530878 7:31066171-31066193 CCACACCATCCCTGCCCTCAGGG - Intronic
1023417635 7:39948163-39948185 CCCACCCAGGCCTGCCCTCCTGG + Intergenic
1023769401 7:43541286-43541308 CCAACCCAGCCCTGTCTGCAGGG + Intronic
1023843472 7:44108998-44109020 CCACACCAGGCCTGCCCTGAAGG + Intronic
1024842141 7:53599770-53599792 AAACCTCAGCCCTGCCCTGATGG + Intergenic
1025026617 7:55521725-55521747 CCTGCCCTGCCCTGCCCTGTGGG - Intronic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1026679685 7:72456234-72456256 CCCACCAAGCCCAGCCATGAAGG - Intergenic
1026928742 7:74211130-74211152 CCCACCCCGCCCAGCCCTGCCGG + Intronic
1027051555 7:75024556-75024578 CCACCCCGGCCCTGCCCTGGAGG - Intronic
1028963723 7:96778272-96778294 CCTACCCAGGCCTGCCCAGAAGG - Intergenic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1030125919 7:106152390-106152412 CCAACCCCACCAAGCCCTGAGGG - Intergenic
1033237703 7:139651165-139651187 CAGCCCCTGCCCTGCCCTGATGG + Intronic
1033599948 7:142882156-142882178 CAGCCCCAGCCCTGCCCAGAGGG - Intronic
1034468128 7:151241814-151241836 GGGACCTAGCCCTGCCCTGAGGG + Intronic
1034931483 7:155167180-155167202 CGAACCCTGCCCTGCCCCGGAGG + Intergenic
1035478891 7:159165766-159165788 ACAACCCAGACATGCACTGACGG + Intergenic
1037517336 8:19645830-19645852 CCAGGCCAGCACTGCCCTGGGGG - Intronic
1037807981 8:22069084-22069106 CTTGCCCTGCCCTGCCCTGAAGG + Intronic
1038584272 8:28775536-28775558 CCAACCCAGCCCAGCCAATATGG - Intronic
1039069084 8:33633959-33633981 CCAGCCCTGCCCCGCCCTGCAGG + Intergenic
1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG + Exonic
1041763695 8:61394443-61394465 CTAACCCTGCCCCGACCTGATGG - Intronic
1042084127 8:65089116-65089138 CTAACCCAGCCCCTACCTGATGG + Intergenic
1045056480 8:98372463-98372485 CAAACCCAGCTCTGCCCAGTGGG + Intergenic
1045389696 8:101703361-101703383 TCAGCACAGCCCTGCCTTGAAGG + Intronic
1046271048 8:111898611-111898633 CCACCCCATGCCTGGCCTGAAGG - Intergenic
1046745512 8:117871783-117871805 CCACCCCAGCCCTACCCTAGGGG - Intronic
1047214429 8:122864949-122864971 CCCACAGAGCCCTGCCCTCAGGG - Intronic
1048371697 8:133784191-133784213 CCAACCCTGCCCCCACCTGATGG - Intergenic
1049386337 8:142344818-142344840 GCAGCCCAGCCCTGGCCTGAGGG - Intronic
1049436185 8:142587304-142587326 TCCACCCAGCCCTGCCCTTGGGG + Intergenic
1049443606 8:142620059-142620081 CCACCCCAGCCATGCACGGAAGG + Intergenic
1049462258 8:142735647-142735669 CTGACCCAGCTCTGCCCTCAAGG + Exonic
1049541375 8:143210683-143210705 GGACCACAGCCCTGCCCTGAAGG + Intergenic
1049571593 8:143372511-143372533 CCAGCCCAGCCCTGCCCCCGTGG - Intronic
1049655778 8:143796392-143796414 CAAACCCAGCCCTGTACTGTTGG + Intronic
1049685319 8:143937099-143937121 CCAAGCCAGCCCCGCCCTGTGGG - Intronic
1051273211 9:15374918-15374940 CCAACCCTGCCCCCACCTGATGG + Intergenic
1052307194 9:27023851-27023873 CTAACCCTGCCCCGACCTGATGG + Intronic
1056380417 9:86052682-86052704 CCAACCCAGCGCTGCTGTCAGGG + Intronic
1056731052 9:89167088-89167110 CCAGCACACCCCTGCCCTGGGGG + Intronic
1056797226 9:89666827-89666849 AGAACCCAGCCCTGCAGTGAGGG - Intergenic
1057173111 9:92975689-92975711 CTGCCCCAGCCCTCCCCTGAGGG + Intronic
1057797516 9:98169405-98169427 CCTCCCCAGCCCTGCCCCCACGG + Intronic
1058627466 9:106949988-106950010 CCAACCTAGACCTGACCAGAGGG + Intronic
1059405824 9:114098070-114098092 CCCACCCAGCCCCGCCCCGCGGG + Intronic
1060558857 9:124526322-124526344 GCACCCCTGCTCTGCCCTGAAGG + Intronic
1060859634 9:126944016-126944038 CCAACCCAGCTTTGACCAGAGGG - Intronic
1060974165 9:127754954-127754976 CCAGCCCAGCCCGACCCTGCCGG + Intronic
1061024833 9:128041770-128041792 CTGACTCAGCCCTGCCCTGAGGG + Intergenic
1061363164 9:130156656-130156678 CACACACAGCCCTGCCCTCATGG + Intergenic
1061822820 9:133238266-133238288 CCAACCCTGCCCAGCTCTGGGGG - Intergenic
1062016214 9:134292642-134292664 CGTACCCAGCCCTCCCCTGCAGG + Intergenic
1062237951 9:135521696-135521718 GCATTCAAGCCCTGCCCTGAGGG + Intronic
1062241669 9:135544192-135544214 CCAACCCTACCATCCCCTGACGG + Intergenic
1062265212 9:135683759-135683781 CCACCCCAGGCCAGCCCTGAGGG + Intergenic
1062266797 9:135690302-135690324 CCACCCCACCCCTCCCCTCAGGG + Intergenic
1062364913 9:136203917-136203939 CGCACCCACCCCTGCCCAGAGGG + Intronic
1062380339 9:136284008-136284030 CCAAGCCCGCCATCCCCTGAGGG + Intronic
1062410091 9:136419220-136419242 CCTGCCCTGCCCTGCCCTGCCGG - Intronic
1062444480 9:136587930-136587952 CCAACCCAGCCCTGGCTGCAAGG + Intergenic
1062524164 9:136971617-136971639 CCTCCCCAGCCCAGCCCTCAGGG - Exonic
1062592670 9:137281144-137281166 CCAACCCGGGCCTGCCCGGGAGG + Exonic
1062622877 9:137430457-137430479 CCACCCCAGGCCTCCCCTGCTGG - Intronic
1062673308 9:137724274-137724296 CCACCCCCGCCCTGCCAGGAGGG + Intronic
1203444387 Un_GL000219v1:41791-41813 CCAGCCCAGACCTGCCCTCCAGG + Intergenic
1186618634 X:11215009-11215031 CCCACCCCGGCCTGCCCTCAGGG - Intronic
1191767863 X:64720018-64720040 CCTACCCAGCCCAGACCTCAGGG + Intergenic
1191840222 X:65508460-65508482 CAGGCCCAGCCCTGCCCTGCGGG - Intergenic
1192185129 X:68941592-68941614 CCACCCCACCCCCGCCCTGCAGG + Intergenic
1193076690 X:77363084-77363106 CTAACCCCGCCCTCACCTGATGG - Intergenic
1193698510 X:84737959-84737981 GCACCCCAGCCCTGGCCTGGAGG - Intergenic
1195392328 X:104375580-104375602 CAACCCCAGCCCTGCTCTGCGGG + Intergenic
1200002041 X:153067164-153067186 AGCACCCAGCCCTGCCCTGTGGG - Intergenic
1200005691 X:153082861-153082883 AGCACCCAGCCCTGCCCTGTGGG + Intergenic
1200083884 X:153593346-153593368 CCACCCCAGCCCTGACTGGAAGG + Intronic
1200114679 X:153764938-153764960 CCAGCCCAGCCCTGCCCCTGGGG - Intronic
1201077095 Y:10196629-10196651 CAAACCCAGCTCTGCCTTGTGGG + Intergenic