ID: 1089611223

View in Genome Browser
Species Human (GRCh38)
Location 11:119670512-119670534
Sequence GGTCCCAGTGGGCCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 225}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089611223_1089611236 24 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611236 11:119670559-119670581 GAGGAGTGGTGTGGTGGCTTGGG 0: 1
1: 1
2: 2
3: 28
4: 418
1089611223_1089611235 23 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611235 11:119670558-119670580 GGAGGAGTGGTGTGGTGGCTTGG 0: 1
1: 0
2: 3
3: 35
4: 470
1089611223_1089611228 -5 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611228 11:119670530-119670552 GGACCTTGTTTCTCTGGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 164
1089611223_1089611231 5 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611231 11:119670540-119670562 TCTCTGGAGTGGGTGACAGGAGG 0: 1
1: 0
2: 3
3: 23
4: 349
1089611223_1089611227 -6 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611227 11:119670529-119670551 GGGACCTTGTTTCTCTGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 165
1089611223_1089611234 18 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611234 11:119670553-119670575 TGACAGGAGGAGTGGTGTGGTGG 0: 1
1: 0
2: 3
3: 68
4: 472
1089611223_1089611233 15 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611233 11:119670550-119670572 GGGTGACAGGAGGAGTGGTGTGG 0: 1
1: 0
2: 5
3: 44
4: 623
1089611223_1089611232 10 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611232 11:119670545-119670567 GGAGTGGGTGACAGGAGGAGTGG 0: 1
1: 0
2: 5
3: 98
4: 1191
1089611223_1089611230 2 Left 1089611223 11:119670512-119670534 CCTGCATGGGGCCCACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1089611230 11:119670537-119670559 GTTTCTCTGGAGTGGGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089611223 Original CRISPR GGTCCCAGTGGGCCCCATGC AGG (reversed) Intronic
900232602 1:1568539-1568561 GGTCGCAGTGGGCCCCGTGATGG + Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900616623 1:3568406-3568428 GGCCTCCGTGGGCCCCATGAGGG - Intronic
900930699 1:5735176-5735198 GGTCCCTGTGTGCCCCACTCCGG - Intergenic
900936880 1:5771623-5771645 GTTCCCACTGGCCCCCATGCCGG - Intergenic
901027233 1:6285109-6285131 GGGCCCAGGGGGCCCAAAGCAGG + Intronic
901254821 1:7813940-7813962 GGACAAAGTGGGCACCATGCAGG + Intronic
901300696 1:8198150-8198172 GATCCCAGTGTCCCCCCTGCAGG - Intergenic
901677158 1:10892230-10892252 GGTGCCAGTGGGAGCCATGGAGG - Intergenic
902159675 1:14519916-14519938 GCACCCAGAGGGCCCCATGATGG + Intergenic
904500231 1:30908852-30908874 GGCCCCAGTGCGCCCCCCGCGGG + Intergenic
906201441 1:43963028-43963050 AGGCCCAGTGTGCACCATGCAGG - Intronic
907761773 1:57368227-57368249 GGTGCCAAGGGGCCCCCTGCAGG - Intronic
908303427 1:62785008-62785030 GGTAGCAGTGAGCCCCATGTGGG - Intronic
913709707 1:121470717-121470739 TGTCACACTGGGCCCTATGCTGG + Intergenic
914196717 1:145451607-145451629 TGTCCCACGGGGCCACATGCTGG - Intergenic
914240484 1:145849601-145849623 GGGCCCACTGGCCCCCACGCTGG - Exonic
918243572 1:182640633-182640655 GGTCCCAATGGGCCCACTGTGGG + Intergenic
921196195 1:212760183-212760205 GGTACCAGTGGCCCACAGGCTGG - Intronic
924251824 1:242140695-242140717 TGTCTCAGTTGGCCCCATGGTGG - Intronic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1063543865 10:6961406-6961428 GGTCCCAGAGGGCCTCTTGGAGG + Intergenic
1065082427 10:22141319-22141341 GGTCCCAGTGGGGTCCAAACTGG - Intergenic
1066325592 10:34354788-34354810 TGTCCCAGTGGTCCCCATGATGG + Intronic
1066410233 10:35161448-35161470 GGTCCCAGTGGACTCCAGCCTGG + Intronic
1067224361 10:44365841-44365863 GCTGCCAGTCAGCCCCATGCTGG - Intergenic
1067432109 10:46251616-46251638 GCTTCCCCTGGGCCCCATGCTGG - Intergenic
1067577767 10:47418991-47419013 GTTTCCCCTGGGCCCCATGCTGG + Intergenic
1070734177 10:78852162-78852184 GGTACCAGTGGGCACCAGGATGG + Intergenic
1071502981 10:86216721-86216743 GGTTCCATGGGGCCCCAGGCAGG + Intronic
1072808693 10:98443558-98443580 GGTTCCAGTAGGCCCCGTGGTGG - Intronic
1073102419 10:101013451-101013473 GATCCCAGTGGGCTTCATGGAGG + Intronic
1075468753 10:122672246-122672268 GGTCACAGTGGGGCCACTGCAGG - Intergenic
1075807378 10:125199748-125199770 GGTCCCTGTGGGGCCACTGCAGG - Intergenic
1076783060 10:132735114-132735136 AGACCCTGTGGGCTCCATGCAGG + Intronic
1078104407 11:8349727-8349749 TGTCCCAGAGCTCCCCATGCAGG + Intergenic
1079093594 11:17496939-17496961 AGTCACAGTGGGCCCCAGGTGGG - Intronic
1079153551 11:17923357-17923379 GGTGCCAGAGGGCCCAATCCTGG + Intronic
1081620248 11:44615111-44615133 GCTCCCAGGGTGCCCGATGCAGG - Intronic
1084307604 11:68297214-68297236 GGACACAGAGGGCCCCAGGCTGG - Intergenic
1084644321 11:70445841-70445863 GGTCCCCGTGACCCCCATGCTGG - Intergenic
1087698269 11:101406407-101406429 GCTCCCAGGGTGCCTCATGCAGG + Intergenic
1087789371 11:102391068-102391090 GTTCCCAGTGGTCCCCATCCCGG + Intergenic
1089212404 11:116814377-116814399 GGTCCCTGTGGGCACCAGGGAGG - Intergenic
1089611223 11:119670512-119670534 GGTCCCAGTGGGCCCCATGCAGG - Intronic
1089703416 11:120259574-120259596 GGACCCAGGAGGCCCCATGAGGG - Intronic
1089787036 11:120915143-120915165 GGTCTCAGTGGGTTGCATGCAGG - Intronic
1091529374 12:1339751-1339773 GGTCTCTGTGTGCCCCAGGCAGG + Intronic
1093315854 12:17648520-17648542 TGTCCCAGTGTGCCCCAGCCTGG + Intergenic
1094433797 12:30398996-30399018 GGTCCATGTGGGCCCCAGGGAGG - Intergenic
1094829433 12:34293251-34293273 GACCCCCGTGGGCCCCACGCAGG + Intergenic
1102019620 12:109672972-109672994 GGTCCAAGAGAGCCCCATGAAGG - Intergenic
1103060023 12:117851156-117851178 GGTCCCAGTGGCCCTAAGGCTGG + Intronic
1103939956 12:124496167-124496189 GGTCCCCGTGGCTCCCTTGCTGG - Intronic
1104467103 12:128999553-128999575 AGCCCCAGTGGGGCCCCTGCAGG + Intergenic
1104814537 12:131638151-131638173 GGTCCCAGTGGGTGCCAGGCTGG + Intergenic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1110980238 13:81889039-81889061 GATCCCAGTGGGAGCCCTGCAGG + Intergenic
1111838816 13:93424064-93424086 GGTTTCAGTGTGCCCCATGGTGG + Intronic
1113001327 13:105641326-105641348 GAGCCCAGTGGGCCCCATGTTGG + Intergenic
1113376202 13:109766824-109766846 AGTGCCAGTGGGTCACATGCAGG - Intronic
1113848917 13:113407096-113407118 GGTCCCAGTGGGGATGATGCAGG + Intergenic
1119669468 14:76507596-76507618 GGTCCCAGAGGGGCACATCCTGG - Intergenic
1120723903 14:87916686-87916708 GGTCCCAGGGGCCGCCCTGCTGG + Intronic
1122885406 14:104708315-104708337 GGACCTACTGGGCCCCAGGCAGG + Intronic
1122934166 14:104948274-104948296 ACTCCCAGAGGGCCCCGTGCCGG - Exonic
1123018492 14:105386692-105386714 GGTCCCTGGGGCCCCCTTGCTGG + Intronic
1123052974 14:105556087-105556109 GAACCCAGTGGGCACCAGGCTGG - Intergenic
1124258332 15:28164087-28164109 GGTCACAGCGGTTCCCATGCTGG - Intronic
1128727436 15:69998648-69998670 GCTCCCCTTGGGCCCCATGATGG + Intergenic
1129031004 15:72617673-72617695 GGTCCCAATGGGGCACATGTGGG + Intergenic
1129451219 15:75652313-75652335 TGCCCCAGTGGGCCCCCAGCAGG - Intronic
1130159916 15:81388416-81388438 GGTCCCAGTGAGCTCCAAGAGGG - Intergenic
1131034983 15:89216239-89216261 GGTCTGAGTGGGCCCTCTGCAGG - Intronic
1132289065 15:100686618-100686640 GCTCCCCGAGGGCCACATGCTGG + Intergenic
1132415679 15:101617165-101617187 GGGCCAAGTGGGCACCCTGCTGG - Intergenic
1132613442 16:828917-828939 GGTCCCAGTGGGCGGGATGTGGG - Intergenic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1132696430 16:1204209-1204231 GGTCCCAGCGGTCACCGTGCCGG - Exonic
1135237763 16:20774724-20774746 GGCTCCAGTGGGTCCCAGGCAGG + Intronic
1139590178 16:67928985-67929007 GGTCCCACTGAGCCTCAAGCTGG + Exonic
1141171869 16:81696660-81696682 GGTCCCACTGCGTACCATGCTGG - Exonic
1141697796 16:85628342-85628364 GGTCCCTGGGGGTCCCCTGCGGG - Intronic
1141961505 16:87412218-87412240 TATGCCAGTGGGCCCCCTGCAGG - Exonic
1143114783 17:4576366-4576388 TGTCCTAGTGGGCACCGTGCAGG + Intergenic
1143408854 17:6696530-6696552 GGTCCCAAGGGGGCCCATCCAGG - Intronic
1143502490 17:7347403-7347425 GGTGCCAGTTGGACCCAGGCGGG + Intronic
1145255721 17:21321216-21321238 GGACCAAGTGGGCCCCAGGAGGG - Intergenic
1145320894 17:21766732-21766754 GGACCAAGTGGGCCCCAAGAGGG + Intergenic
1145911056 17:28543430-28543452 AGTCCCAGTGAGCACCTTGCCGG + Intronic
1146128469 17:30249030-30249052 GCTCCCATGGGGTCCCATGCTGG + Exonic
1146133502 17:30297967-30297989 GGTGCCTGTGGGATCCATGCTGG + Intergenic
1146273163 17:31497743-31497765 GGTGACAGTGGCCCCCAAGCAGG + Intronic
1147139641 17:38453915-38453937 GGCCCCAGTACGCCCCAGGCCGG - Intronic
1147946560 17:44083671-44083693 GGTTTCAGTGTGCCCCCTGCAGG + Intronic
1148237073 17:45976133-45976155 GTTTCCCGTGGGCCCCATGTGGG - Intronic
1151443395 17:74148114-74148136 GTCCCCACTGGGCTCCATGCTGG - Intergenic
1152887302 17:82859997-82860019 GGGCCCAGAGGACGCCATGCTGG - Intronic
1152907525 17:82977009-82977031 GGCCCCAGGTGGCCCCAGGCAGG + Intronic
1154268598 18:12900019-12900041 GGACCCAGTGGACCCACTGCAGG - Intronic
1155370023 18:25089107-25089129 GTTCCCACTGGGCTCCAAGCTGG - Intronic
1160413828 18:78693599-78693621 TCTCCCTGTGGGCTCCATGCTGG - Intergenic
1160633285 18:80262344-80262366 TGTGCCAGTGCGCCCCCTGCTGG - Intergenic
1161255613 19:3307540-3307562 GGTCGCAGGGGCTCCCATGCAGG + Intergenic
1161267012 19:3368771-3368793 GGACCCTGAGTGCCCCATGCAGG + Intronic
1161592233 19:5134082-5134104 GGTCCCAGAGAACCCCAGGCAGG + Intronic
1161698761 19:5784031-5784053 GTTTCCAGATGGCCCCATGCGGG - Exonic
1163557092 19:17999010-17999032 GGCCCCAGCGGGGCCCATGGGGG + Exonic
1165094054 19:33401050-33401072 GGTACCAGTGGGGCCTGTGCAGG + Intronic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1165942421 19:39421657-39421679 GGTCTCACTGTGACCCATGCTGG - Intronic
1166066012 19:40359404-40359426 GCTCCCAGCGCGCCCCATCCAGG - Intronic
1167950130 19:53019748-53019770 GGTGCCAGTGGCCACCATTCTGG - Intergenic
925026523 2:611795-611817 GGGCTCAGGGGGCCTCATGCAGG + Intergenic
926309179 2:11662162-11662184 GGTCACAGTGAGCCACCTGCTGG - Exonic
927204734 2:20600007-20600029 GGTCCCAGGGGGACCCCTGGGGG + Intronic
930512201 2:52359271-52359293 GGGCCAAGTGAGCCCCAGGCAGG - Intergenic
931269325 2:60687860-60687882 GGTCCCAGTGGGAAGAATGCTGG + Intergenic
931769996 2:65489161-65489183 GGTCCCACTGGACCCTGTGCTGG + Intergenic
932275863 2:70451823-70451845 ATTCCCAGTGGGACCCAAGCAGG + Intronic
934710002 2:96508517-96508539 GGTCCCGCTGGGCCGCACGCTGG - Intergenic
934736723 2:96693405-96693427 GGACCCAGTGGGGCCCAGGAGGG - Intergenic
935229240 2:101081556-101081578 GGTCCCAGGGGGCCCACTTCAGG - Intronic
935901756 2:107800160-107800182 GGTGCCAGTGGTCCTCAAGCTGG - Intergenic
935921721 2:108022686-108022708 GGTCCCAGTGGACCTCTTCCTGG - Intergenic
937336759 2:121066977-121066999 CATTCCAGTGGGCCCCTTGCTGG - Intergenic
937426296 2:121801710-121801732 GGTGTCAGTGGGCCCCAGCCGGG + Intergenic
942942973 2:181640908-181640930 AGCCCCAGAGGGCCCCATCCGGG + Intronic
943114262 2:183646663-183646685 GGTCTCAGTAGGCCCCAACCAGG - Intergenic
943448339 2:188018023-188018045 GATCCCAGCTGACCCCATGCTGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947958154 2:234212808-234212830 GGGACCTGTGGGCCCCATGCTGG - Intergenic
948599310 2:239099447-239099469 GCTGCCTGTGGGCCCCATGAGGG - Intronic
948728073 2:239946831-239946853 GGGGCCAGAGGGCCCCATGCTGG + Intronic
948826512 2:240575746-240575768 GGACCATGTGGGCCCCAGGCTGG + Intronic
1170695276 20:18652152-18652174 GGGCCCAGGGGGCAGCATGCAGG + Intronic
1170791426 20:19512371-19512393 GGACCCAAAGGGCCCCATGCTGG - Intronic
1170881877 20:20304045-20304067 GTTCCAAGTGAGCCCCTTGCAGG - Intronic
1171390632 20:24799469-24799491 GGTCAGCGTGGGTCCCATGCTGG - Intergenic
1175637946 20:60601226-60601248 GGTCTCAGTGTGCCCCATTTGGG + Intergenic
1175818868 20:61897776-61897798 GGTTCCAGGGGGCCTCAGGCAGG + Intronic
1178882397 21:36459862-36459884 AGTCCCAGTGGGGCCCTTGGGGG + Intergenic
1181161798 22:20964166-20964188 GCCCCCAGTGTGACCCATGCAGG + Intergenic
1183476835 22:38040253-38040275 GGTCTCACTGGCCCCCAGGCTGG - Intronic
1183692440 22:39398342-39398364 TGACCAAGTGGGCCCCAGGCAGG - Intergenic
1184410835 22:44325408-44325430 GGTCCCGGTGATGCCCATGCTGG - Intergenic
1184477305 22:44728710-44728732 GCTCCCAGTGGAACCCAAGCAGG - Intronic
1184479137 22:44736976-44736998 GGTCCCGGTGGGGCCCTGGCCGG - Exonic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185227464 22:49661129-49661151 GATCCCAGCAGGGCCCATGCTGG + Intergenic
1185331729 22:50255034-50255056 GGACCCTGTGGGCCCTGTGCAGG - Intronic
1185373292 22:50470609-50470631 GGTCCCTGTAGGCCCCAGGCTGG - Intronic
950764816 3:15265899-15265921 GTGCCCAGTGGTGCCCATGCGGG - Intronic
951135901 3:19103810-19103832 GCTCCCAGTGAGACCAATGCAGG - Intergenic
952764376 3:36942550-36942572 GGCCCCACTGGGATCCATGCAGG + Intronic
952857427 3:37783886-37783908 GGTCCCTGTGTGCCCCAGGAAGG + Intronic
952926876 3:38326683-38326705 GAGCCCTGTGGGCCCCATGGAGG - Intergenic
953234074 3:41090934-41090956 GTTCCGAGCAGGCCCCATGCAGG - Intergenic
954602121 3:51878070-51878092 GTTCTCAGTAGGCCCCTTGCAGG + Intergenic
954752926 3:52823801-52823823 GGTGCCAGTGTGCCCCAGGTGGG - Exonic
954878542 3:53819019-53819041 GGTACATGTGGGGCCCATGCGGG - Exonic
956442208 3:69291533-69291555 TGTCCCAGTGTCCCCCAAGCAGG - Intronic
961427462 3:126859255-126859277 GATGTCAGTGGGCCGCATGCAGG + Intronic
961438841 3:126938776-126938798 GCTCCCACAGGTCCCCATGCAGG + Intronic
961446755 3:126984625-126984647 GGTGCCAGTGGGGCCCAGGAAGG + Intergenic
961677927 3:128578859-128578881 GGCTCCAGATGGCCCCATGCTGG - Intergenic
962317882 3:134370091-134370113 GGTCCAAGTGGGCCCTTTTCTGG - Intronic
963605062 3:147406275-147406297 GGTGCCAGTGGTCCCCTTGAGGG + Intronic
963899430 3:150720016-150720038 GGTCCAAGTGGGCACCATTGTGG + Intergenic
967831242 3:193921932-193921954 ATTTCCAGTGGGCCCCATTCAGG - Intergenic
968069976 3:195778740-195778762 TCTCCCAGTGGGCCCCTTGGCGG - Intronic
968544812 4:1193415-1193437 AGTCTCAGTGGGCCCCACCCTGG + Intronic
969511869 4:7622653-7622675 AGTCCCAGGGGGCTTCATGCAGG + Intronic
969678056 4:8625845-8625867 GATCCCAGATGGTCCCATGCTGG + Intergenic
969679011 4:8631482-8631504 GATCCCAGATGGTCCCATGCTGG + Intergenic
969679967 4:8637139-8637161 GATCCCAGGTGGTCCCATGCTGG + Intergenic
972778593 4:42266009-42266031 GGGCTCAGTGGGCCCCACACTGG + Intergenic
975524145 4:75331043-75331065 GTTCCCAGTGAGACCAATGCAGG + Intergenic
978173441 4:105702064-105702086 TGACCCAGTGGTCCCCATGGTGG + Intronic
980680588 4:136155089-136155111 GCTCCATGTGGGCCCCATGGAGG + Intergenic
982291969 4:153790128-153790150 CGTACCAGGGGGCACCATGCTGG + Intergenic
985552953 5:542538-542560 GGGCTCAGTGGGCCCCAGGCAGG - Intergenic
985553194 5:543518-543540 GGGCTCAGTGGGCCCCAGGCAGG + Intergenic
985574514 5:667793-667815 GGTCCGCGTGGGCCCCATCAGGG + Intronic
985574581 5:668082-668104 GGTCCGCGTGGGCCCCATCAGGG + Intronic
988468367 5:31512969-31512991 GGAGCCAGTGAGGCCCATGCTGG + Intronic
989480601 5:41925725-41925747 GGTCCCCAGGGGCCCCATGAAGG - Intronic
995269861 5:110207867-110207889 AGTCCCAGTGGGCCCCTAGAGGG - Intergenic
996404113 5:123089927-123089949 GGTCCCAGTGGCCCTCTTCCCGG + Intronic
997386945 5:133481017-133481039 GGTTCCAGTGGAACCCAGGCTGG + Intronic
997447618 5:133952921-133952943 GGTACCAGTGGGCACCATAGGGG - Intergenic
998366445 5:141635800-141635822 GGTCCCACTGTGGCCCAAGCTGG + Intronic
998394780 5:141811655-141811677 GGGCCCAGTGGAACCCATGGGGG + Intergenic
1001702348 5:173716261-173716283 GGTCCTGGTGGGCTCCAGGCAGG - Intergenic
1002043391 5:176529709-176529731 GGTCCCATGGAGCCCCATGCTGG - Exonic
1002372678 5:178767666-178767688 GGTCCCAGTGGGGCCCATTGAGG - Intergenic
1002754752 6:148405-148427 TGTGCCAGTGCGCCCCCTGCTGG + Intergenic
1003961489 6:11213288-11213310 GGAACCAGTGGGCCCCACGTGGG - Exonic
1004724691 6:18300006-18300028 AGACCCACTGGGCCCAATGCTGG + Intergenic
1008051339 6:46903086-46903108 GTCCCCAGTGAGCCCCATGCCGG - Intronic
1010174961 6:73017486-73017508 GGTCCCACTGTTCCCCATGCAGG + Intronic
1018370378 6:163162748-163162770 GGACCCAGTGGGCCTCACCCTGG - Intronic
1019246281 6:170712473-170712495 AGGCCCAGTGGGCCCCGCGCTGG + Intergenic
1019392142 7:794662-794684 GGTCCCTGTGGGCTCCATCCCGG + Intergenic
1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG + Intergenic
1019493510 7:1325751-1325773 GGTACCAGGGCCCCCCATGCAGG + Intergenic
1022045276 7:26617764-26617786 GGTCCCAGTCTGCCCCACACTGG + Intergenic
1023129315 7:36986829-36986851 CCTCCCAGTGGGACCCCTGCTGG - Intronic
1023637233 7:42224779-42224801 AGCCCCAGGGGGCGCCATGCAGG - Intronic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1025901871 7:65751248-65751270 GGTCCCTTTGGGCCCCAGGTTGG - Intergenic
1031082750 7:117274463-117274485 GAGCCCAGTGGGCCTCATGATGG + Intergenic
1032637624 7:133727357-133727379 GGGCTCAGTGGGCCACCTGCTGG + Intronic
1032781992 7:135170853-135170875 GGTCCGCGGGCGCCCCATGCTGG + Intergenic
1033060565 7:138102370-138102392 GGTCTCAGTGTTCCCCATGCTGG - Intronic
1035395268 7:158530834-158530856 GGGCCATGTGGGTCCCATGCAGG + Intronic
1035501791 8:95216-95238 AGGCCCAGTGGGCCCCGCGCTGG - Intergenic
1037569716 8:20148024-20148046 GGTCTCATTGGCCCCAATGCAGG - Exonic
1038485348 8:27931240-27931262 AGTCACACGGGGCCCCATGCTGG + Intronic
1048068556 8:130998417-130998439 AGCCACAGTGGGCCGCATGCTGG - Intronic
1048282658 8:133116511-133116533 GGGCCCAGGGGGCCCCTTGCTGG + Intronic
1048930598 8:139312478-139312500 GGTGACAGTGTGCCCCAGGCAGG - Intergenic
1049400913 8:142426817-142426839 GGTCCCGCTGGGCCCCAGGGAGG - Intergenic
1049437817 8:142595769-142595791 GGTCCCTGGAGGGCCCATGCAGG - Intergenic
1049497349 8:142942509-142942531 GGACACAGTTGGCCCCAGGCTGG - Intergenic
1049588940 8:143446811-143446833 GGCCCCAGAGGGCCCCCTGTGGG - Intronic
1049640477 8:143712904-143712926 ACTCCCAAGGGGCCCCATGCAGG - Intronic
1051157009 9:14159413-14159435 AGTCTCACTGGGCTCCATGCAGG - Intronic
1053409037 9:37903900-37903922 GGTCCCTGCGGGCCCCACCCAGG - Exonic
1055458299 9:76493223-76493245 GGTCCCAGTGGGATCCATACAGG + Intronic
1055708405 9:79033346-79033368 GCTCCATGTGGGCCCCATGGTGG + Intergenic
1055986321 9:82058989-82059011 AGTTCCAGAGGGCCCCATGAGGG - Intergenic
1056965734 9:91161668-91161690 GGTCCCAGGTGGCCCCTGGCCGG + Intergenic
1057290922 9:93807156-93807178 GACCCTAGTGGGCACCATGCAGG - Intergenic
1057806759 9:98225121-98225143 GGCCCCAGAGGGCCGCAGGCAGG + Intronic
1061678542 9:132231476-132231498 GGACCCAGGGGGCCCCTGGCTGG + Intronic
1062165066 9:135103566-135103588 TGAGCCAGTGGGGCCCATGCAGG + Intronic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1062320363 9:135987915-135987937 GCTCCCAGGGGGACCCATACTGG - Intergenic
1062325137 9:136009282-136009304 GTTCCCAGCGGGCCCCATGGGGG + Exonic
1062446330 9:136596908-136596930 GGTCCCAGTGGGCCCCCAGGAGG + Intergenic
1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG + Intronic
1203780957 EBV:100642-100664 GGTCCCGGTGGGCACCGAGCAGG - Intergenic
1203607045 Un_KI270748v1:67856-67878 AGGCCCAGTGGGCCCCGCGCTGG + Intergenic
1185524853 X:769907-769929 GGTCCCACAGGGCCCCTGGCAGG - Intergenic
1187595790 X:20771489-20771511 GGACCCAGTGAGCCAGATGCAGG - Intergenic
1192232821 X:69277814-69277836 GGGCTCAGTGGGCCCCAGCCAGG + Intergenic
1195264272 X:103164667-103164689 GGTGTCAGTGGACACCATGCAGG - Intergenic
1195712850 X:107788624-107788646 AGTCCCAATGTGCTCCATGCTGG - Intronic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic
1198764247 X:140064708-140064730 CGTCCCAGTGAGTCCCATGGAGG - Intergenic
1202095367 Y:21243903-21243925 GGTACCAGTGGCCCCCAGCCTGG + Intergenic