ID: 1089611367

View in Genome Browser
Species Human (GRCh38)
Location 11:119671341-119671363
Sequence CAAGCTGCTCCCTTTGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089611367_1089611375 14 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611375 11:119671378-119671400 GGGTTGTAACCTCTCTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1089611367_1089611368 -7 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611368 11:119671357-119671379 CAGCTTGTCCCTATTCCTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 131
1089611367_1089611373 12 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611373 11:119671376-119671398 AAGGGTTGTAACCTCTCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 119
1089611367_1089611378 25 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611378 11:119671389-119671411 TCTCTTCTGGGGTCCCTGGCTGG 0: 1
1: 0
2: 7
3: 30
4: 280
1089611367_1089611369 -6 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611369 11:119671358-119671380 AGCTTGTCCCTATTCCTGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 114
1089611367_1089611374 13 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611374 11:119671377-119671399 AGGGTTGTAACCTCTCTTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 125
1089611367_1089611376 21 Left 1089611367 11:119671341-119671363 CCTCTTACAAAGGGAGCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1089611376 11:119671385-119671407 AACCTCTCTTCTGGGGTCCCTGG 0: 1
1: 0
2: 2
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089611367 Original CRISPR CAAGCTGCTCCCTTTGTAAG AGG (reversed) Intronic
902850224 1:19149496-19149518 CTCTCTGCTCCCTTTCTAAGTGG - Intronic
904304158 1:29576630-29576652 GAAGCTGGTCCCTTAGCAAGAGG - Intergenic
905412494 1:37780408-37780430 CAGGGTGGGCCCTTTGTAAGTGG + Intergenic
905510204 1:38513333-38513355 CAGGCGGCTCCCTATGTAAGTGG + Intergenic
908780580 1:67686112-67686134 CAAGCTGCTCAACGTGTAAGTGG + Exonic
914747684 1:150511735-150511757 CCAGCAGCTCCCTTTGTAGGGGG - Exonic
917191826 1:172426209-172426231 CAAGCTGCCACCTTTGGAAAAGG - Intronic
918121268 1:181542856-181542878 CAAGATGCTCCATATATAAGGGG + Intronic
922884015 1:229004127-229004149 CAAGCTGTACCCTTTCTCAGGGG + Intergenic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1064109429 10:12525626-12525648 AAAGCAGCTCCCTAAGTAAGTGG - Intronic
1069793847 10:71040152-71040174 CAGGCTGCTCCCTTAGCCAGAGG - Intergenic
1070760534 10:79021542-79021564 CAGGCTGCTCCCTTGGCACGGGG + Intergenic
1071443984 10:85729214-85729236 CAAGCTGCTCCATTTGTTCTTGG - Intronic
1072082169 10:92043477-92043499 CAAATGACTCCCTTTGTAAGTGG - Intergenic
1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG + Intergenic
1074453363 10:113577252-113577274 CCAGCTGCTCCCAAGGTAAGTGG + Exonic
1074931271 10:118128641-118128663 TGATCTGCTCCCTTTGTATGGGG + Intergenic
1076144860 10:128109873-128109895 CAAGCTGTTCCCTCTGTGACAGG + Intronic
1080847354 11:36037713-36037735 CAAGCTGCCCCCTCTGAAACTGG + Intronic
1082986390 11:59173545-59173567 GAAGCCGCTCCCTTTGTCTGCGG + Intronic
1083286234 11:61660885-61660907 CAACCTGCTCCTTTTGTTACCGG - Intergenic
1086935660 11:92743230-92743252 CAAGGTGCTCCCCTTAAAAGAGG - Intronic
1088518541 11:110667250-110667272 CAAGCTGACTCCTTTGTTAGGGG + Intronic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1090836621 11:130458745-130458767 CTCACTGCTCCCTGTGTAAGAGG - Intronic
1091448782 12:560000-560022 CAAGCTGCTGCCTTGGCAGGTGG + Intronic
1092187633 12:6493050-6493072 GAAGCTTCTCTCTTGGTAAGTGG - Exonic
1093268770 12:17031747-17031769 CAAGCTGCTTCCTCTGTCAAGGG + Intergenic
1099022291 12:77421678-77421700 GCAGGTGCTCCCTTTGTAATTGG + Intergenic
1101550955 12:105761349-105761371 GAAGCTGCTCCTTTTGTATCTGG - Intergenic
1103446824 12:121000230-121000252 CAAGCTGCCCCCTTTCTATAAGG + Intronic
1104331723 12:127853198-127853220 CAAGCAGCACCCTTTGTGAGGGG + Intergenic
1106942530 13:34793954-34793976 CTAGCAGCTCCCTTCTTAAGGGG - Intergenic
1107265007 13:38542981-38543003 CAAGCTCGTGCCTTTGTAAATGG + Intergenic
1109224712 13:59679141-59679163 GAAGCTGCTCCCTTTTAATGAGG + Intronic
1114185530 14:20398807-20398829 AATGCTGCTCCCTTTGTAAAGGG + Intronic
1116864201 14:50018134-50018156 AAAGCTGGCCCCTTTGTAAAGGG - Intergenic
1118900177 14:69979873-69979895 CAATCAGCTCCCTTTGGAGGAGG - Intronic
1120063045 14:80007150-80007172 CACGCTGCTCCATTTGAAAACGG + Intergenic
1120524058 14:85557207-85557229 TAAGCTTCTACCTTAGTAAGAGG - Intronic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1124610696 15:31206525-31206547 CAGGCTGCTCATTTTGTAATTGG - Intergenic
1125908620 15:43416233-43416255 ATATCTGCTGCCTTTGTAAGAGG + Exonic
1126699640 15:51356314-51356336 CAAGTGGCTCCTTTTGTCAGAGG - Intronic
1127624168 15:60763887-60763909 GAGGCTGCTCCCTTTGTGATTGG + Intronic
1136929689 16:34408002-34408024 CCAACTGCGCCCTTAGTAAGGGG + Intergenic
1136974885 16:35003803-35003825 CCAACTGCGCCCTTAGTAAGGGG - Intergenic
1137844179 16:51670926-51670948 CAAGTTACTCCATTTGTAAAGGG + Intergenic
1138255417 16:55554190-55554212 CAGGCTGATCCTTTTGTTAGGGG - Intronic
1138383138 16:56617470-56617492 CCAGCTGCTCCTTTTGCAGGCGG - Intergenic
1149501501 17:57156251-57156273 CTGGCTGCTCCTTTTGAAAGGGG - Intergenic
1158367027 18:56747708-56747730 CAGGCTGCTCCCTTTGCCTGGGG - Intronic
1163416221 19:17188101-17188123 CAAGGAGCTCTCTTTGGAAGAGG - Intronic
1164593623 19:29519689-29519711 CAAGCAGCTGCCTATGCAAGGGG - Intergenic
1165950943 19:39473639-39473661 CAGGCTGGTCCCTTTGAAGGAGG + Intronic
1166278137 19:41769905-41769927 AAATCTGCTCCCTTTATAACAGG + Intronic
1166434217 19:42753804-42753826 CAATCTGCTCTCTTTGTAACAGG - Intronic
1166437360 19:42779131-42779153 CAATCTGCTCTCTTTGTAACAGG - Intronic
1166453995 19:42925250-42925272 CAACCTGCTCTCTTTGTAACAGG - Intronic
1166483540 19:43193816-43193838 CAATCTGCTCTCTTTGTAACAGG - Intronic
1166486009 19:43212904-43212926 CAATCTGCTCTCTTTGTAACAGG - Intronic
1166640519 19:44491219-44491241 CAAGCCCCTCCCTTGGTTAGAGG + Intronic
925809400 2:7684349-7684371 CTTGCTGCTGCCTCTGTAAGTGG + Intergenic
929612353 2:43280686-43280708 CAAGCTGCTGCCTTTATCATGGG - Intronic
930370258 2:50492587-50492609 CAACCTGCTCCGTTTGCAAGGGG - Intronic
930906189 2:56571355-56571377 GATGCTTCTCCCTTTGTAACTGG - Intergenic
932542065 2:72665129-72665151 CATGGTGCTCCCTTTGTCAGAGG - Intronic
938742509 2:134246114-134246136 CAGTCTGTTCCCTTTGGAAGTGG - Intronic
940757323 2:157698553-157698575 CTAGCTGCTCCCTGGGGAAGGGG + Intergenic
941171555 2:162143938-162143960 CAAGCTGTTCCCCATGTAGGGGG - Intronic
941377976 2:164754301-164754323 CAGTCTCCTCCCTTTGTACGTGG + Intronic
942183976 2:173406793-173406815 AAAGATGTTTCCTTTGTAAGAGG - Intergenic
946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG + Intronic
947779940 2:232750399-232750421 CCAGCTGCTCCCTTTCCCAGAGG + Intronic
948190512 2:236054768-236054790 CCAGCTCCTGCCTTTGGAAGCGG + Intronic
948301345 2:236909519-236909541 CTACCTGCTCCCTGTGTGAGGGG - Intergenic
948349092 2:237323433-237323455 TAAGTTGTTTCCTTTGTAAGTGG + Intergenic
1169106423 20:2999541-2999563 GAAGCAGATCCATTTGTAAGTGG + Intronic
1169539561 20:6584135-6584157 CAAACTGCTCCGGTTGAAAGGGG + Intergenic
1169626237 20:7572932-7572954 CAGTCTGCTCCCTCTGAAAGAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171258593 20:23710941-23710963 TGGGCTGCTCCCTTTGGAAGAGG + Intergenic
1171265911 20:23772403-23772425 TGGGCTGCTCCCTTTGGAAGAGG + Intergenic
1185096898 22:48813410-48813432 CAAGCTGGTGCCTTTGGAAAAGG - Intronic
950353561 3:12382090-12382112 CAAGGTCATCCCTTAGTAAGTGG + Intronic
953725964 3:45399149-45399171 CAACCTTCTCCCTTTTTAAAAGG + Intronic
957876346 3:86151586-86151608 CAAGCTGCTTCTTTTGTGATAGG + Intergenic
959425541 3:106183122-106183144 CAGGCTGCTGTCTGTGTAAGAGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967093967 3:186161635-186161657 CAAGCTGCTGCCAATGCAAGTGG - Exonic
973013334 4:45105173-45105195 CAGGTTTCTCCCTTTTTAAGGGG + Intergenic
975496358 4:75039843-75039865 CATGCTGATCCCTCTGTGAGAGG + Intronic
978121792 4:105088744-105088766 CAAGCCTGTCCTTTTGTAAGAGG + Intergenic
980810136 4:137866963-137866985 CAAGCTGCTGCCTTTTTAGCTGG - Intergenic
982536316 4:156610511-156610533 CAAGCTGCTACCATTTTAAAAGG + Intergenic
982751948 4:159172649-159172671 CATGCTACTTCCTCTGTAAGTGG + Intronic
983859616 4:172688819-172688841 TAAGCTGCTCCCTTCTTAAAAGG + Intronic
985649849 5:1102387-1102409 CAACCTCCTCCCTTTCTCAGTGG + Intronic
990307081 5:54504290-54504312 CCAGGTTCTCCCTTTGTAATGGG - Intergenic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
996062329 5:119045892-119045914 CCAGCTGCTCCATTAGGAAGAGG - Intronic
996875670 5:128237967-128237989 CAACCTGCTCCCAATGAAAGAGG - Intergenic
998783460 5:145683805-145683827 CAAGCAGCCCCCTTTGTGATTGG - Intronic
999925877 5:156376579-156376601 TCAGCTGCTCCATTTGTAAATGG - Intronic
1001725108 5:173890000-173890022 AAAGCTGCTGCTTTTCTAAGGGG - Exonic
1003144454 6:3498205-3498227 CATGCTGCTTCCTCTGAAAGAGG - Intergenic
1004871402 6:19908168-19908190 CAAGCATCTTCATTTGTAAGAGG + Intergenic
1008298979 6:49811054-49811076 CAAGCTGACTCCTTTGTTAGGGG - Intergenic
1009817204 6:68751596-68751618 CAAAATGCTCCCTTGGTATGGGG - Intronic
1010287384 6:74094858-74094880 CAACCTGCTGCCTTTGAAGGTGG + Intergenic
1011034575 6:82959345-82959367 CAAGCTGCTTCTGTTGTGAGCGG - Intronic
1013265506 6:108493580-108493602 CAAGTTGCTCCTTTTGGAAATGG - Intronic
1016221855 6:141682812-141682834 CTTGCTCCTCCCTTGGTAAGAGG - Intergenic
1016570596 6:145507910-145507932 CAGCCTGCTCCCTTGGTCAGTGG + Intronic
1017721143 6:157244004-157244026 CAAGCTGCACCCTTTGTTACAGG + Intergenic
1018618698 6:165710487-165710509 CAAACTGATCCCTTTTAAAGAGG + Intronic
1037368532 8:18148436-18148458 CAAACTGCTTCCTTTGTAGTTGG - Intergenic
1045737666 8:105316977-105316999 CAAGATGCTCAGTGTGTAAGAGG - Intronic
1047628554 8:126681303-126681325 CAAACTTCTCCATTTATAAGGGG - Intergenic
1048216757 8:132502672-132502694 AAAGCTACTGCCTTTCTAAGCGG + Intergenic
1186095135 X:6092328-6092350 CTACCTGCTCCCTTTGTCTGAGG - Intronic
1186732870 X:12429077-12429099 CAATCTGCTGCCTGTGTCAGGGG + Intronic
1187611809 X:20951551-20951573 CAAGCTGCCCCATGTGGAAGAGG - Intergenic
1192047757 X:67694561-67694583 CATGCTGCTTCCTATGTTAGAGG + Intronic
1192261233 X:69506757-69506779 CCAGCTCCTTCCTTTGTCAGGGG - Intronic
1193596767 X:83455690-83455712 TAAGTTGCTCCATGTGTAAGTGG + Intergenic
1194903738 X:99547417-99547439 CAAGTTCATCCCTTTGTATGTGG - Intergenic
1195165196 X:102213141-102213163 CCAGATGCTCCCTCTGTGAGTGG + Intergenic
1195193662 X:102473950-102473972 CCAGATGCTCCCTCTGTGAGTGG - Intergenic
1195239648 X:102938058-102938080 GAGGCTGCTCCTTTTGTGAGTGG - Exonic
1195491087 X:105470740-105470762 CCAGCTTCTGCCTTGGTAAGAGG - Intronic
1199640537 X:149857107-149857129 CAATCTGCTCTCTTTATAACAGG + Intergenic
1200978493 Y:9239170-9239192 CAAGGTTCTCCTTTTGTAATGGG + Intergenic