ID: 1089611579

View in Genome Browser
Species Human (GRCh38)
Location 11:119672358-119672380
Sequence TCATTACCCCAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089611571_1089611579 -8 Left 1089611571 11:119672343-119672365 CCTCTCCCCACCTTGTCATTACC 0: 1
1: 0
2: 2
3: 25
4: 341
Right 1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 3
3: 12
4: 190
1089611569_1089611579 -1 Left 1089611569 11:119672336-119672358 CCCTGGGCCTCTCCCCACCTTGT 0: 1
1: 1
2: 2
3: 35
4: 368
Right 1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 3
3: 12
4: 190
1089611570_1089611579 -2 Left 1089611570 11:119672337-119672359 CCTGGGCCTCTCCCCACCTTGTC 0: 1
1: 1
2: 5
3: 55
4: 475
Right 1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 3
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089611579 Original CRISPR TCATTACCCCAGAGGGAGAA GGG Intronic
901114083 1:6827140-6827162 GCATTACACCAGTGAGAGAATGG - Intronic
901355343 1:8642365-8642387 TCAGTTACACAGAGGGAGAAAGG - Intronic
901928426 1:12581784-12581806 TCACCAGCACAGAGGGAGAAAGG + Intronic
902789426 1:18756602-18756624 TCTTTACAGCAGAGTGAGAATGG + Intergenic
905858567 1:41330957-41330979 TCATTCCACCGGAGGGAGCAGGG + Intergenic
907929026 1:58981807-58981829 CCATTATTCCAGAAGGAGAAGGG - Intergenic
911061556 1:93752175-93752197 TCACTACCACAGAGTGTGAAGGG + Intronic
911472797 1:98339119-98339141 TCATTACCCTAAATGGATAAAGG + Intergenic
911973387 1:104463947-104463969 TCATTAACCCACAAGGAGAGAGG - Intergenic
915171630 1:153982169-153982191 CCGTTTCCCTAGAGGGAGAAGGG + Exonic
919127443 1:193412770-193412792 TCAAAATCCCAGAGGGAAAAAGG + Intergenic
920219352 1:204385170-204385192 ACAGTTCCCCAGAGGGAGAGGGG + Intergenic
920257380 1:204664813-204664835 GACTGACCCCAGAGGGAGAATGG - Intronic
921669002 1:217906072-217906094 GCATAGCCCCAGAGGGTGAAGGG - Intergenic
922041453 1:221902488-221902510 TCAATAACCAGGAGGGAGAAGGG - Intergenic
922167284 1:223126882-223126904 TAATGAGGCCAGAGGGAGAAGGG + Intronic
922218435 1:223539621-223539643 TGATTCCCCCAGTGGGAGTAGGG - Intronic
923466461 1:234251378-234251400 TCATTACCCTATCGGGCGAAAGG - Intronic
1063243323 10:4193353-4193375 TCCTAACCCCAGATGTAGAAAGG + Intergenic
1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG + Intergenic
1065868222 10:29932752-29932774 TCTTTACAGCAGAGTGAGAAGGG - Intergenic
1068837402 10:61569747-61569769 TCATTTCCCCAGTGCCAGAATGG - Intergenic
1075138394 10:119808230-119808252 ACATTACATCAGAGGGAGAGGGG + Intronic
1075150736 10:119928128-119928150 TGATAACCCCATAGGGAAAATGG + Intronic
1076277576 10:129216727-129216749 TGATTACCTAAGAGGAAGAAGGG + Intergenic
1076489261 10:130845878-130845900 TAGATACCCCAGAGGGAGGATGG + Intergenic
1076518608 10:131064517-131064539 CCATTACCCATTAGGGAGAAGGG - Intergenic
1077402033 11:2363751-2363773 ACATTCCGCCAGAGGGAGAGTGG + Intergenic
1082028559 11:47589360-47589382 CCATTACCCCACAGGGTGCATGG - Intergenic
1085584956 11:77693528-77693550 TGATCATCCCAGATGGAGAATGG - Exonic
1087007387 11:93483277-93483299 TCCTTAGCCCAGAGGGAGGCGGG - Intronic
1087696526 11:101383396-101383418 TGATAAGCCAAGAGGGAGAAGGG - Intergenic
1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG + Intronic
1090642439 11:128740961-128740983 TTGTTAACCCAGAGGGAAAAAGG + Intronic
1091041255 11:132283992-132284014 GCATTGCCTCAGAGGGAGGAAGG - Intronic
1092143443 12:6199664-6199686 TAGTTGCCCCAGAGGGAAAAAGG - Intergenic
1093297955 12:17415435-17415457 TCATAACCTCACAGGGAGAATGG + Intergenic
1094468535 12:30780161-30780183 TCAAAACGCCAGAGGGAGAGAGG - Intergenic
1097317833 12:58191337-58191359 TCAATTACCCAGAGGGAGTATGG - Intergenic
1097842626 12:64336838-64336860 TCTTTAGCATAGAGGGAGAAGGG - Intronic
1097993684 12:65863935-65863957 TCATTTCTCCAGATGGAAAATGG + Intronic
1098231484 12:68375869-68375891 TCACTACACCAGAGGGTGAAGGG - Intergenic
1099824821 12:87761656-87761678 TAATTCACCCAGAGGGAGTAAGG - Intergenic
1104035239 12:125093004-125093026 TGGTGTCCCCAGAGGGAGAATGG + Intronic
1104613750 12:130251695-130251717 CTCTTCCCCCAGAGGGAGAACGG - Intergenic
1104670055 12:130674371-130674393 TCTTTACCGCAGTGTGAGAATGG + Intronic
1107018126 13:35724983-35725005 TCATTATGCCAGAAGGAGAAGGG + Intergenic
1107598470 13:41988305-41988327 CCATAACCACAGAAGGAGAATGG + Intergenic
1108493029 13:51000125-51000147 TCATTAGCCCCAAGGGGGAAAGG + Intergenic
1109798798 13:67347783-67347805 TCATTTCCCTTGTGGGAGAATGG + Intergenic
1110684775 13:78358976-78358998 TCCTTAGCCCAGAGGGTGGATGG - Intergenic
1115877676 14:37878985-37879007 TCTTTACCCCAGAGGCACACAGG - Intronic
1118501480 14:66366234-66366256 TCATGAGCCCAGAGGGAGATAGG - Intergenic
1118636168 14:67750660-67750682 TCTTTATCCTAGAGGGAAAAAGG - Intronic
1119429296 14:74555496-74555518 TCCTTACCCCAGGGGGATGAGGG + Exonic
1119438379 14:74612309-74612331 TCATTACCGGAGAGGGAGCGAGG + Exonic
1120075344 14:80150666-80150688 TCAAGACACCAGAGAGAGAAGGG - Intergenic
1122859620 14:104576708-104576730 TCACTGCCCCAGAGGGAGCTGGG + Intronic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1124719124 15:32096960-32096982 TCTTCATCCCAGAGGGAGAGGGG + Intronic
1124866113 15:33492981-33493003 TCATCATTCCAGAGGGAGGAGGG + Intronic
1124880655 15:33639633-33639655 TCATTACCCCAGTGGGAGCTGGG + Intronic
1125092679 15:35812729-35812751 GCATGACCCCAGAGAGGGAATGG + Intergenic
1126720772 15:51576778-51576800 TCATCAGGCCTGAGGGAGAAAGG + Intronic
1126939877 15:53755703-53755725 CCATTACCGCAGAAAGAGAAGGG + Intronic
1127221601 15:56886742-56886764 TCCTTCCCCCAGATGCAGAAAGG + Intronic
1127561158 15:60137766-60137788 TCACTAACCCAGAGTGGGAAAGG + Intergenic
1128903726 15:71449091-71449113 TCACTGCCCCAGAGGGTCAAGGG + Intronic
1133808583 16:9144188-9144210 TCAGTCCCTCAGAGGCAGAATGG + Intergenic
1134265119 16:12685879-12685901 TGACAACCCCAGAGGAAGAAAGG - Intronic
1135143376 16:19940549-19940571 TCCTTACAGCAGCGGGAGAATGG - Intergenic
1136117048 16:28101132-28101154 TCATCACCCAGGAGGGAGAACGG + Intronic
1138503162 16:57461313-57461335 CCAGGACCCCAGAGGGAGACAGG + Intergenic
1140078435 16:71723303-71723325 ACATCACCCCAGCGGGAGGATGG - Intronic
1145913105 17:28553930-28553952 TCCTTGCCACAGAGGGAGACAGG + Exonic
1146553954 17:33807031-33807053 TCATTAGCTCGGAGGCAGAAGGG + Intronic
1149380539 17:56088870-56088892 TTATTGGCCCAGAGGGAAAAAGG + Intergenic
1150627342 17:66849837-66849859 TCATCAGGCAAGAGGGAGAAAGG - Intronic
1153084731 18:1271417-1271439 TCATTCCCCCACAAGGACAAAGG + Intergenic
1153274462 18:3354257-3354279 TCTTTCCCCCATAAGGAGAACGG - Intergenic
1153355230 18:4126883-4126905 TCATTTCCCTTGAGGGAGAAAGG - Intronic
1153839573 18:8994223-8994245 TCATTACAGCAGCGTGAGAATGG - Intergenic
1155094361 18:22541905-22541927 TGATGACCCTAAAGGGAGAAGGG - Intergenic
1155900298 18:31381481-31381503 TCATTGGTCCAAAGGGAGAAGGG - Intronic
1155991826 18:32286109-32286131 TCATTATCCCTGAGGGAGAAAGG - Intronic
1156227834 18:35126669-35126691 TTATATCTCCAGAGGGAGAAGGG + Intronic
1156438637 18:37161198-37161220 GCATGACACCAGAGGTAGAAAGG - Intronic
1163036965 19:14575687-14575709 TCATTTCACCAGAGGCTGAAGGG + Intergenic
1163795065 19:19333164-19333186 TCATGGCCCCAAATGGAGAAGGG + Intronic
1166241015 19:41493847-41493869 TCTATACCCCAGAAAGAGAATGG - Intergenic
1166332901 19:42088933-42088955 TCATTTCCCGGGTGGGAGAAGGG + Intronic
1167536461 19:50056021-50056043 TAATCACCCCAAAGGGAGAGAGG + Intergenic
1167622397 19:50567314-50567336 GGGTGACCCCAGAGGGAGAAGGG + Intronic
1168579172 19:57539395-57539417 ACATTACCCAAGAGGGAAATGGG + Exonic
925320541 2:2963229-2963251 ACATTAGGCAAGAGGGAGAAGGG + Intergenic
925656976 2:6159530-6159552 TCTATAGCCCAGAGGGAGATGGG - Intergenic
926513029 2:13806272-13806294 TCTTTACCTCAGAGAAAGAATGG - Intergenic
926956854 2:18311181-18311203 TTATTACCCCAGTTGGAGACAGG - Intronic
928126536 2:28620467-28620489 GCATTACCCCTGAGGGTGATGGG + Intronic
929652966 2:43700593-43700615 TAATTACCCAAGAAGGAAAACGG - Exonic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
933648018 2:84828060-84828082 CCATTACCCCAGGGGGAGAAGGG + Intronic
934074602 2:88416984-88417006 GCAAAACCCCAGAGGGAAAAGGG + Intergenic
934550843 2:95260649-95260671 TCTTGTCCCCAGAGGGAGAGAGG - Intergenic
935804880 2:106735428-106735450 TTATTCCCTCAGAGTGAGAACGG + Intergenic
936517767 2:113193031-113193053 TCATTGCTGCAGAGGGAAAAGGG - Exonic
940120657 2:150261138-150261160 TCCTTATCCCAGTTGGAGAAGGG + Intergenic
940356484 2:152748584-152748606 TGATTGGCTCAGAGGGAGAAGGG - Intronic
940941496 2:159566490-159566512 TCAATACTGCAAAGGGAGAAGGG - Intronic
943273064 2:185832070-185832092 TCTTTACACCAAAGGGACAATGG + Intronic
945719145 2:213397014-213397036 TCATTAGCACAGAAGGTGAAGGG - Intronic
948891653 2:240909789-240909811 CCATTACCCCAGAGTGAGCAGGG + Intergenic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1174949190 20:55025871-55025893 TCATGTCTCCAGATGGAGAAAGG - Intergenic
1175137208 20:56833151-56833173 TCATAACCCCACAGTGAGGAAGG - Intergenic
1177363584 21:20104682-20104704 TCATTTCCCCAGTGCTAGAATGG + Intergenic
1178021142 21:28409694-28409716 ACATCAACCCAGAGAGAGAAGGG - Intergenic
1179096485 21:38320585-38320607 TGACTCCCCCAGTGGGAGAATGG - Intergenic
949332589 3:2938716-2938738 TCATTTCCTGAGAGGGAGAGAGG + Intronic
951536317 3:23744006-23744028 TCATTGCCCCAGGGGAAGGATGG + Intergenic
951695027 3:25437497-25437519 TCATGAGTTCAGAGGGAGAAGGG - Intronic
953143421 3:40250338-40250360 ACATTCCAACAGAGGGAGAAAGG - Intronic
954461763 3:50630828-50630850 ACATTTCCCCACAGGTAGAAGGG + Intronic
957635872 3:82783676-82783698 TCACTAGCCCATAGGTAGAAAGG - Intergenic
960179657 3:114560578-114560600 GCACTACCACAGAGGGAGACAGG - Intronic
960582569 3:119293792-119293814 TCTTTACCCCAGAGTGGGAGGGG + Intergenic
962285031 3:134078118-134078140 ACATTCTCCCAGAGGGATAATGG + Intronic
971154596 4:24067936-24067958 TCATTCCCCCAGAGGGGCCAGGG + Intergenic
971960760 4:33484037-33484059 TCACTCCTCCACAGGGAGAATGG + Intergenic
976144891 4:82032753-82032775 TCCTGACACCAGAGGGAGGAAGG - Intronic
976460507 4:85306071-85306093 TAGTTATCCCAGAGGAAGAATGG - Intergenic
980081341 4:128347679-128347701 TCATCACCCCAGATGGAAACAGG + Intergenic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
986014835 5:3748722-3748744 TCTTTACGGCAGAGTGAGAATGG + Intergenic
987048786 5:14131979-14132001 TCATCACCCCAGTGCAAGAAGGG + Intergenic
987587005 5:19868117-19868139 TCTTTACACCAGGGTGAGAATGG + Intronic
990052414 5:51521307-51521329 TCATAAATCCAAAGGGAGAATGG + Intergenic
998591371 5:143482345-143482367 TCAATACCCCAAAAGAAGAAAGG - Intergenic
998955123 5:147430767-147430789 TCATTACCTCAGATAGACAAAGG - Intronic
1001494392 5:172177787-172177809 TCATTAGCCCAGAGACAGAAGGG + Intronic
1001935034 5:175697578-175697600 TGAATACCCCAGCGGGGGAATGG - Intergenic
1002337476 5:178489841-178489863 ACAATACCCAAGAGGTAGAAAGG + Intronic
1006149916 6:31981573-31981595 TCACCACTCCACAGGGAGAATGG - Intronic
1006156217 6:32014311-32014333 TCACCACTCCACAGGGAGAATGG - Intergenic
1006196736 6:32247654-32247676 TCATTTGCACAGAGAGAGAAAGG - Intergenic
1006952353 6:37833379-37833401 TGATTACCCCTGAGAGAGGAAGG - Intronic
1007279350 6:40698950-40698972 ACATTAACCCAAATGGAGAAAGG + Intergenic
1010447304 6:75962528-75962550 GAATAAACCCAGAGGGAGAAGGG + Intronic
1011553474 6:88550780-88550802 TTGTTACCCCAGAGGGATCACGG - Intergenic
1012107601 6:95183456-95183478 TCATTACCCCAAAATGAAAAGGG - Intergenic
1012398688 6:98827502-98827524 ACATGAGCCCAGACGGAGAAGGG + Intergenic
1013516744 6:110894338-110894360 TCTATACCCCAGATGGGGAATGG + Exonic
1013656171 6:112249039-112249061 TCATTAGGCTAGACGGAGAAGGG + Intronic
1013884221 6:114942399-114942421 TCATTAGCTCACAAGGAGAAAGG - Intergenic
1014287409 6:119515980-119516002 TCATTACACTAGAAGAAGAATGG - Intergenic
1015144618 6:129971835-129971857 TCTTTGCTCCAGAGGGAGACAGG - Intergenic
1016053097 6:139550691-139550713 TTATTACCCCAGAGGGAAAAGGG - Intergenic
1016631906 6:146242657-146242679 TCATTACCTGAGAGGTAGTAGGG + Intronic
1017074747 6:150607238-150607260 TGATTGCAGCAGAGGGAGAATGG + Intronic
1018371283 6:163170497-163170519 TCCTGACCCCAGCGGGAGCAGGG - Intronic
1019600721 7:1882405-1882427 TCATTGCTCCAGCGGGAGATGGG + Intronic
1021797375 7:24270193-24270215 TGATTACCCCAGTGGGAGGTAGG + Intergenic
1022041864 7:26588760-26588782 TCACTGCCCCAGAGGCTGAAAGG + Intergenic
1022973158 7:35535680-35535702 TCTTTACCCCACAGGGAGATTGG + Intergenic
1024373953 7:48617513-48617535 ACATCTGCCCAGAGGGAGAACGG + Intronic
1028161559 7:87491764-87491786 CCATTACCCCAGAGGGAAGTGGG + Intergenic
1033409966 7:141108554-141108576 TCATCACCCAAGAGTGAGATGGG + Intronic
1034900044 7:154902533-154902555 TCAGGAACCCAGAGGGAGGAGGG - Intergenic
1035245843 7:157561514-157561536 TCAGGGCCCCAGAGGGAGGATGG - Intronic
1036088657 8:5640594-5640616 TCTTTATACCAGTGGGAGAACGG + Intergenic
1036117147 8:5971022-5971044 TCATCACCGCAGAGGGAGAGAGG + Intergenic
1038947320 8:32375528-32375550 TCCTTAGCCCAGAGTTAGAAAGG + Intronic
1039550796 8:38441368-38441390 TCACTACCTCACTGGGAGAAGGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042529412 8:69799549-69799571 TCCTTACAACAGTGGGAGAATGG - Intronic
1045859061 8:106795348-106795370 TTTGTACCCCACAGGGAGAAAGG + Intergenic
1047348147 8:124048448-124048470 ACATTCCCCCAGAGGCAGCATGG - Intronic
1047629526 8:126692023-126692045 TCAATGCCCCAGATGGACAATGG + Intergenic
1049302297 8:141878027-141878049 TCATTGAGCCAGAGGGAGAAGGG - Intergenic
1052528135 9:29647813-29647835 GCATCACCCCAGAAGGAAAAAGG + Intergenic
1053011227 9:34634944-34634966 TCATACCCCCAAAGGAAGAATGG + Exonic
1053684360 9:40507474-40507496 TCATCACCCATGTGGGAGAAAGG + Intergenic
1054279365 9:63117479-63117501 TCATCACCCATGTGGGAGAAAGG - Intergenic
1054297454 9:63342938-63342960 TCATCACCCATGTGGGAGAAAGG + Intergenic
1054395472 9:64647446-64647468 TCATCACCCATGTGGGAGAAAGG + Intergenic
1054430118 9:65152646-65152668 TCATCACCCATGTGGGAGAAAGG + Intergenic
1054500265 9:65868886-65868908 TCATCACCCATGTGGGAGAAAGG - Intergenic
1054947809 9:70814775-70814797 TCCATACCCTTGAGGGAGAAAGG + Intronic
1057082209 9:92181415-92181437 TCTGTACCCCAGGGGGAGCAGGG - Intergenic
1057311164 9:93944136-93944158 TCATCAGCCCACAAGGAGAAAGG + Intergenic
1058971468 9:110087211-110087233 TGATCACCCCAGGAGGAGAAAGG + Intronic
1059074893 9:111182312-111182334 TCATTACACCATAAGAAGAATGG - Intergenic
1061505296 9:131028412-131028434 TCATTATCCCAGATGGGCAAAGG - Intronic
1061928783 9:133821546-133821568 CTATCACCCCAGAGGGCGAAAGG + Intronic
1186791832 X:13007290-13007312 TCATCTGCACAGAGGGAGAATGG - Intergenic
1188263111 X:28040673-28040695 ACATTAGCCCAGAGGGTGATGGG + Intergenic
1193090879 X:77492876-77492898 TCTTTACAGCAGTGGGAGAACGG + Intergenic
1193437197 X:81489777-81489799 TAATTACCCTGGAGGCAGAATGG - Intergenic
1198955918 X:142130386-142130408 TCAGTAGCCCAGACGGAGCAAGG - Intergenic
1199070516 X:143469961-143469983 TCTTTACAGCAGAGTGAGAATGG - Intergenic
1199456944 X:148039672-148039694 TCATTAGCTGAGAGTGAGAATGG + Intergenic
1201696908 Y:16836041-16836063 TCATCAACCCACAAGGAGAAAGG + Intergenic
1201785194 Y:17768746-17768768 TCTGTACCACAGAGGGAAAAGGG + Intergenic
1201816359 Y:18137241-18137263 TCTGTACCACAGAGGGAAAAGGG - Intergenic
1202391201 Y:24372432-24372454 CCATTACCCAAGGGAGAGAAGGG + Intergenic
1202479583 Y:25297684-25297706 CCATTACCCAAGGGAGAGAAGGG - Intergenic