ID: 1089612367

View in Genome Browser
Species Human (GRCh38)
Location 11:119676662-119676684
Sequence CCTCCTCCCCAAGAATCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089612361_1089612367 9 Left 1089612361 11:119676630-119676652 CCATGAGCACAGGCATTCTAGGC 0: 1
1: 0
2: 9
3: 146
4: 1249
Right 1089612367 11:119676662-119676684 CCTCCTCCCCAAGAATCTGGGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1089612358_1089612367 25 Left 1089612358 11:119676614-119676636 CCGCAGGGCACGTGCTCCATGAG 0: 1
1: 0
2: 0
3: 27
4: 196
Right 1089612367 11:119676662-119676684 CCTCCTCCCCAAGAATCTGGGGG 0: 1
1: 0
2: 0
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089612367 Original CRISPR CCTCCTCCCCAAGAATCTGG GGG Intronic
900234724 1:1582678-1582700 CCTCTTCCCCAAGACCCTGACGG + Intergenic
900256005 1:1698479-1698501 CATCCTCCCCAAGGGGCTGGGGG - Intronic
900264673 1:1751089-1751111 CATCCTCCCCAAGGGGCTGGGGG - Intergenic
900755332 1:4430589-4430611 TCTCCTCCACTAGAAGCTGGAGG + Intergenic
900761336 1:4473257-4473279 TCTTCTCCCCTAGAATATGGGGG - Intergenic
901067263 1:6500264-6500286 CCTGCTCCCCAACAATCTTGGGG - Intronic
901875231 1:12163690-12163712 CCTCCTCCACAAGACACTGGAGG - Intergenic
903601767 1:24547171-24547193 CCCCCCCCCCAAGAGACTGGAGG - Intergenic
903858412 1:26350902-26350924 CCTCCTTCCTGAGAAGCTGGTGG + Intronic
904128327 1:28258403-28258425 TCTTTTTCCCAAGAATCTGGAGG + Intergenic
907062929 1:51449704-51449726 CAATCTCCCCAAGAATTTGGGGG + Intronic
908134889 1:61121386-61121408 CCTCCTCCCCAAGAATTCTAGGG + Intronic
908674154 1:66583362-66583384 CCTACTCCCCAAGACTCAGTAGG - Intronic
911841569 1:102688629-102688651 CCTCCTCTCCAAGAATTTGAAGG - Intergenic
912816470 1:112832716-112832738 CCTGCTACAAAAGAATCTGGGGG + Intergenic
917069586 1:171135572-171135594 CCTCCTCCCCATGATGCTGATGG + Intergenic
918342815 1:183581388-183581410 CCTCCTGCCCCAGCCTCTGGCGG - Intronic
919855599 1:201704117-201704139 CCCTCTCCCCAAGAACCGGGTGG + Intronic
921583054 1:216917065-216917087 TCTCCTCCCCTAGAATCTCAGGG + Intronic
923916887 1:238516855-238516877 CCACCTCCCTGAGAATTTGGAGG - Intergenic
1062885234 10:1011105-1011127 CCCCCACCCCGAGACTCTGGTGG + Intronic
1063590995 10:7395312-7395334 CGTCCTCCCTCAGAATCTTGAGG + Intronic
1063636740 10:7788960-7788982 ACTCCTCCCCCAGGACCTGGGGG - Intronic
1065045997 10:21748014-21748036 TCTCCTCTCCAATAAGCTGGAGG - Intergenic
1066459426 10:35600197-35600219 CCTCCTCCCCAAGCCACAGGAGG - Intergenic
1067008621 10:42690246-42690268 CCTTCTCCTGCAGAATCTGGAGG - Intergenic
1067823671 10:49553197-49553219 CAGCCTCCCCAAAAATTTGGAGG + Intergenic
1068795929 10:61080394-61080416 GCTACTGCACAAGAATCTGGAGG - Intergenic
1069492153 10:68870279-68870301 TCTTCTTCCCAAGATTCTGGAGG - Intronic
1069704695 10:70451065-70451087 GCTCCACCCCAAGAGGCTGGGGG - Intergenic
1070967594 10:80538986-80539008 CCTCCTGCCGGAGGATCTGGAGG - Intronic
1071204070 10:83254017-83254039 TCACCTCTCCAAGAATTTGGAGG + Intergenic
1071687289 10:87773004-87773026 CCTCCTCCAGATGAAGCTGGAGG - Intronic
1071941387 10:90595255-90595277 CCTCCTCCCCAAGTTCATGGAGG - Intergenic
1072584643 10:96770665-96770687 CCACCTCATCAAGAATTTGGAGG + Intergenic
1072894715 10:99356966-99356988 GCCCCTCCCCTTGAATCTGGGGG - Intronic
1073329691 10:102661910-102661932 CCTCCTCCCCCAGAATTTACAGG - Intergenic
1074237782 10:111603405-111603427 GTTCATCCCCAAGACTCTGGGGG + Intergenic
1074390785 10:113056560-113056582 CCCTCTCCCCAATAATATGGGGG - Intronic
1077009365 11:373350-373372 CCTCATTCCCAAGAGGCTGGTGG - Intronic
1077427547 11:2490545-2490567 ACTCCTCCCCAAGCTTCAGGTGG + Intronic
1080101685 11:28466879-28466901 CCTCCTCCCCAACAGACTGAAGG - Intergenic
1084027125 11:66457907-66457929 GTTCCTCCCCTTGAATCTGGTGG + Intronic
1087809962 11:102599998-102600020 CCTCCTCTCTCAGAATCAGGTGG + Intronic
1088416251 11:109592225-109592247 CCTCCTGCCCCTGAATCTGAGGG + Intergenic
1089612367 11:119676662-119676684 CCTCCTCCCCAAGAATCTGGGGG + Intronic
1090337654 11:125984021-125984043 CCACTTCCCAAAGAATTTGGAGG + Exonic
1090362906 11:126185815-126185837 TCTCCTCCCCAGGACTCTGAAGG - Intergenic
1091601465 12:1920529-1920551 CCTCCTCCCCCAGCCGCTGGCGG + Intergenic
1093660847 12:21754697-21754719 CCTCTTCCCAAAGCATCTTGTGG - Intronic
1094146895 12:27238152-27238174 CAACCTCCCCAGGAATCAGGTGG - Intergenic
1094783543 12:33819664-33819686 CCTCTTCCCCAAGAATCACTAGG + Intergenic
1096562809 12:52449069-52449091 GCTTCTCCCCAAGAAACTTGAGG + Intronic
1097178808 12:57159213-57159235 CCGCCTCCCCATCAATCTGGTGG + Intronic
1098339061 12:69432816-69432838 CCTCCTCCCCTACACCCTGGTGG + Intergenic
1098385107 12:69910271-69910293 CCTCCACCCCAAGGTACTGGTGG + Intronic
1103925955 12:124423421-124423443 CCTCCTGCCCAGCCATCTGGAGG - Intronic
1105002851 12:132702498-132702520 CCTCCTCCTGTAGCATCTGGGGG - Intronic
1110875464 13:80504211-80504233 CCTCCTCCCCTGCCATCTGGAGG + Intergenic
1112125434 13:96461741-96461763 CCCGTTCCCCAAGTATCTGGTGG - Intronic
1112381012 13:98890252-98890274 GCTCCTTCCCAAGTCTCTGGAGG + Intronic
1112559816 13:100502994-100503016 CCTCCTCCCCAGGAATCAGAAGG - Intronic
1112887981 13:104197052-104197074 CCTCCTTCCTAAGAATCATGTGG + Intergenic
1113172659 13:107522918-107522940 CTTCCTTTCAAAGAATCTGGAGG - Intronic
1118620584 14:67610816-67610838 CCCTCTCTCCAAGAATTTGGAGG - Intergenic
1121013739 14:90536031-90536053 GCTCCACCCTATGAATCTGGGGG + Exonic
1122323040 14:100866933-100866955 CCTCCTCCCCCAGAATCACAGGG + Intergenic
1122861923 14:104586632-104586654 CCTCCACCCCAGGAATCAGGGGG + Intronic
1123886688 15:24733759-24733781 TCCCCTCCCCAAGAGTGTGGGGG - Intergenic
1125768727 15:42151417-42151439 CCTCCTCCCCAGAAAGCTGCTGG - Intronic
1128098845 15:64981010-64981032 CATCATCCACAATAATCTGGAGG + Exonic
1128210122 15:65892765-65892787 TCTCTTACCCAAGGATCTGGAGG + Intergenic
1131489399 15:92849459-92849481 CCTCTTCCCCTAGCTTCTGGTGG - Intergenic
1132092624 15:98958311-98958333 CCCAACCCCCAAGAATCTGGTGG + Exonic
1132555899 16:572555-572577 CCTCGTCCCTAAGGATGTGGTGG + Intronic
1132555942 16:572720-572742 CCTCGTCCCTAAGGATGTGGTGG + Intronic
1132555957 16:572775-572797 CCTCGTCCCTAAGGATGTGGTGG + Intronic
1132714499 16:1284031-1284053 CCTCTTCCCACTGAATCTGGAGG + Intergenic
1133562749 16:6965044-6965066 CCTCCTTCCCTGGAGTCTGGGGG + Intronic
1136254583 16:29029572-29029594 CATCCCTCCCAAGAAGCTGGTGG + Intergenic
1136341349 16:29645806-29645828 CTTCTTCCCCAAGAACATGGTGG + Intergenic
1136470868 16:30479153-30479175 CCTCTTCCGCCAGAATCTGCAGG + Exonic
1136983834 16:35082223-35082245 CCTCTTCCCCAAGGTACTGGGGG + Intergenic
1138687926 16:58742163-58742185 CCTCTCCACCAACAATCTGGTGG + Intergenic
1139254361 16:65527159-65527181 TCTCCTCCCCAAGGCTCTAGGGG - Intergenic
1141358966 16:83376766-83376788 CCTCCTCACCTAGAATCAAGGGG - Intronic
1141697462 16:85626814-85626836 CCCCCTCCCCACGAGGCTGGAGG - Intronic
1142157554 16:88539541-88539563 CCTCCTGCCCAGGCACCTGGCGG + Intergenic
1142940956 17:3379549-3379571 CCACCTCACCCAGAACCTGGGGG - Intergenic
1143179706 17:4976861-4976883 CCTCTTCCCCATAAATCTTGGGG - Intronic
1143181264 17:4985939-4985961 CTTTCTCCCCAAGAAGCTGCTGG - Exonic
1143311758 17:5997777-5997799 GCTCCTCCCCCAGAATCAGATGG + Intronic
1144437264 17:15253103-15253125 CCTCCTCCCCAAGACCCTATGGG - Intronic
1144737659 17:17564033-17564055 GCTCCTTCCCAAGACTCAGGAGG - Intronic
1144827996 17:18117206-18117228 CCTCCTCCCCAAGATTCACCTGG - Intronic
1146762566 17:35491145-35491167 CCTCCTCCCCGAGGCTCAGGAGG - Intronic
1147135913 17:38434211-38434233 CCTCCTCCAGGAGAAGCTGGGGG - Intronic
1148682922 17:49484993-49485015 CCCCCTACCCTAGAATCTGACGG - Intergenic
1151835259 17:76578697-76578719 CCTCCTCCCCACTAATTTGAGGG + Intronic
1151945660 17:77318613-77318635 CCTCCTCCCAAAGAGCCTGGAGG - Intronic
1152071863 17:78138062-78138084 CCTGGTCCCCAAGAATGTGCTGG + Exonic
1153067443 18:1062494-1062516 CCTACTGACCAAGAACCTGGAGG - Intergenic
1157291520 18:46413001-46413023 CCCCCTCTCCGAGAAGCTGGAGG + Intronic
1158230020 18:55244108-55244130 CCTCCTCCCCTGGGAGCTGGAGG - Intronic
1158497593 18:57970443-57970465 CCTCCTCCACCTGGATCTGGTGG - Intergenic
1158618941 18:59013511-59013533 CCTGCTCCTCAAGGATTTGGAGG - Intergenic
1158962944 18:62601550-62601572 CCCCCTTCCTATGAATCTGGCGG + Intergenic
1159059400 18:63499242-63499264 CCTACTACCCAAGGATGTGGAGG + Exonic
1160516201 18:79480479-79480501 CCACCTCCCCAGGATGCTGGCGG - Intronic
1160731706 19:644226-644248 CCGCCTTCCCCAGCATCTGGAGG - Intergenic
1160795520 19:943684-943706 CCTCCTCTCCCAGCTTCTGGGGG - Intronic
1162016671 19:7849990-7850012 CCTCCTCCTCAGGCATCTAGGGG - Exonic
1166037223 19:40177582-40177604 CCACATCCCCAAGAATTTGGAGG - Intergenic
1166042993 19:40214320-40214342 CCTCCTCCACAAGAAGCAGGAGG - Intronic
1166266424 19:41687422-41687444 CCTCTTCCCCAGGGATCTGCAGG + Intronic
1166705148 19:44904298-44904320 CCTCCTTCCCCAGACCCTGGGGG - Intergenic
1166913985 19:46181718-46181740 CCGTCTCTCCAAGAATTTGGGGG - Intergenic
1167593103 19:50415001-50415023 CCTCCTCCCTCAGACTCAGGGGG + Intronic
1168250159 19:55137374-55137396 CCTCCTCCCTCAGATTCAGGAGG + Intronic
1168255297 19:55161555-55161577 CCTCCTCCCTCAGACTCAGGAGG + Intronic
926720701 2:15958111-15958133 AATCCTCCCCAAGATTCTGTAGG + Intergenic
926886651 2:17604472-17604494 CCTCCTCCCTAAGCAAGTGGAGG - Intronic
928675854 2:33650369-33650391 CCTCCTCCTCAACTACCTGGAGG + Intergenic
929601834 2:43209465-43209487 GCTGCTCCCCAAGAGCCTGGAGG + Intergenic
930520432 2:52458815-52458837 CCTCCTCCCCAGAAATCTCTAGG + Intergenic
932345115 2:70990351-70990373 CCCCCTCCCCCAGAATGTTGAGG - Intronic
932615539 2:73228931-73228953 CTTCCTCTCCAAGACTCGGGTGG - Exonic
935111145 2:100095309-100095331 TCTCCTCCCCCACAATCTGAAGG + Intronic
936111920 2:109671544-109671566 CCTTCTCCTGGAGAATCTGGAGG + Intergenic
936123830 2:109769855-109769877 TCTCCTCCCCCACAATCTGAAGG - Intergenic
936220857 2:110601611-110601633 TCTCCTCCCCCACAATCTGAAGG + Intergenic
936639783 2:114299060-114299082 GCTCATCACCAACAATCTGGAGG - Intergenic
937712617 2:124995581-124995603 CCTCCTCCTCAAGAATTTGAAGG + Intergenic
938028260 2:127969677-127969699 CCTCCTCTCCCAGCTTCTGGTGG + Intronic
938487208 2:131723547-131723569 CCTCCTCCCCAGGCTGCTGGTGG + Intronic
939821403 2:146961040-146961062 ATTCCTCCCCAAGAATTTGATGG + Intergenic
939984343 2:148815086-148815108 CCATCTCCCCAAGAATTTGGAGG - Intergenic
941735085 2:168965307-168965329 CCTCCTTCCCAGGAGTCTGGGGG - Intronic
942192325 2:173482426-173482448 CCTCTTCCCCAAGCACCTGAAGG - Intergenic
946932945 2:224689570-224689592 CTTCCTGCCCAAAAATTTGGGGG - Intergenic
947589106 2:231374897-231374919 TCTCCTGGCCTAGAATCTGGGGG + Intergenic
947950810 2:234145567-234145589 CAGCCTCCCCCAGAATTTGGAGG - Intergenic
948032225 2:234828330-234828352 CAGCCTCCCCGAAAATCTGGAGG + Intergenic
948379386 2:237542137-237542159 CCTCCTCCCACAGCAGCTGGGGG - Intronic
948775514 2:240286803-240286825 CCTCCTCTGCAAGCATCTGCTGG + Intergenic
1168894329 20:1313173-1313195 CCTCCTCCCCGAGACCCGGGCGG - Intronic
1170131262 20:13022661-13022683 TCTCCTCCCCTTGAACCTGGTGG - Intronic
1175330117 20:58157932-58157954 CCTCCATCCCAAGAATACGGTGG + Intronic
1176023665 20:62975120-62975142 TCCCCTCCCCTTGAATCTGGGGG + Intergenic
1176060507 20:63170425-63170447 CCTCCTCCCCTTGGCTCTGGTGG - Intergenic
1176083634 20:63286105-63286127 CCTCCCCCCCAAGCATGTGGTGG + Intronic
1176132401 20:63501922-63501944 CGTCCTCACCAACAACCTGGGGG + Intergenic
1177260374 21:18722060-18722082 CCACCTCCCAAAAAATTTGGAGG - Intergenic
1179545388 21:42109734-42109756 CCCCCTGCCCGAGAATCTGGGGG + Intronic
1180891967 22:19295562-19295584 CCTCCTGCCTCAGACTCTGGAGG - Intergenic
1182584367 22:31335502-31335524 CTTCCTTCCCAAGAAGCTTGGGG - Intronic
1182634329 22:31712425-31712447 GCTCCTCTCCAAGACTATGGAGG - Exonic
1184187733 22:42876103-42876125 CCTCCTCCCCTGGATGCTGGGGG + Intronic
950210599 3:11120310-11120332 CCTCATAGCCAAGAATGTGGTGG + Intergenic
952768544 3:36976565-36976587 CCTCCTCTCCAAGACTCGGGTGG + Intergenic
954441977 3:50526969-50526991 CCTCCTCCCCATGTCTGTGGTGG - Intergenic
957128873 3:76198200-76198222 CCTCCTCCCTCAGAACATGGTGG + Intronic
961048612 3:123727182-123727204 TATCCTCCCCTAGGATCTGGAGG - Intronic
962396544 3:135019334-135019356 CTTCCACCCCAGGACTCTGGGGG + Intronic
962838034 3:139205957-139205979 CCTCCTCACCAAGGAGCTGGTGG + Intronic
963758389 3:149259494-149259516 CCTCCTCCCCAGGAGTCTCAGGG + Intergenic
966293385 3:178387276-178387298 CATCCTCCCCCAGAGTCTGCTGG + Intergenic
966692261 3:182753949-182753971 CCACAGCCTCAAGAATCTGGTGG + Intergenic
968641666 4:1717895-1717917 AGTGCTCCCCAAGAATCTGGGGG + Intronic
968641668 4:1717901-1717923 CCACCTCCCCCAGATTCTTGGGG - Intronic
968959382 4:3735242-3735264 CCTTCTCCCCTAGAGCCTGGGGG - Intergenic
969342578 4:6551498-6551520 CCTCCTCCTCTTGAGTCTGGTGG + Intronic
970747811 4:19320452-19320474 GCTCGTCTGCAAGAATCTGGTGG - Intergenic
971302619 4:25454383-25454405 CCACCTACCCCAGAACCTGGGGG + Intergenic
977196826 4:94073086-94073108 CCTCCTCCCCAAGAGGCATGTGG - Intergenic
980554976 4:134391950-134391972 CCTCCTTCCAAAGGCTCTGGGGG - Intergenic
985440819 4:189981424-189981446 TCTCCTCCCCAAGCTTCTCGGGG - Intergenic
985493156 5:190909-190931 CCTTCTCCCCAAGGACCCGGCGG - Intergenic
986509547 5:8489913-8489935 CATCCTCCCCCAAAATTTGGAGG + Intergenic
988730142 5:33964232-33964254 CTTCCTCACCCAGAATATGGAGG + Intronic
990111476 5:52330851-52330873 CATGCTCCCCTAGAATCTGCTGG + Intergenic
990283195 5:54273825-54273847 TCCCCTCCCCCAGCATCTGGTGG - Intronic
992139633 5:73782678-73782700 CCTGCTGCCCAAGAAGGTGGTGG + Intronic
992198405 5:74361885-74361907 CATCCTTCCCAAGAGTCAGGTGG + Intergenic
992716363 5:79514412-79514434 CCCCCTCCCCTAGAGGCTGGCGG + Intergenic
993966470 5:94366133-94366155 CAGTCTCCCCAAGAATTTGGTGG - Intronic
998008476 5:138673845-138673867 TCTCCTCCCCTTGAGTCTGGTGG + Intronic
998135376 5:139671562-139671584 CCTCCTCCCCCAGAATCCTGTGG - Intronic
998814220 5:145996020-145996042 GCTCATCCCCAGGAAACTGGTGG - Intronic
999295621 5:150457979-150458001 CCTCCTCCCCTGGACCCTGGAGG - Intergenic
1001085469 5:168697180-168697202 CTTCATCCCCCAGAAGCTGGAGG - Intronic
1002639946 5:180626005-180626027 CCTCCTTCTCATGTATCTGGGGG + Exonic
1002971772 6:2030169-2030191 TCTCCTCCACAAGAGTCTGTGGG + Intronic
1003350454 6:5312875-5312897 CCTGCCCCCAAAGAATCTGGGGG + Intronic
1005542995 6:26833134-26833156 CCACCTCCCTGAGAATTTGGAGG - Intergenic
1005928812 6:30465739-30465761 CCTTCAGCCCAAGAATCTGATGG - Intergenic
1008525476 6:52403273-52403295 CCGCCTGCCCAAGATCCTGGAGG + Exonic
1009013812 6:57875315-57875337 CCACCTCCCTGAGAATTTGGAGG - Intergenic
1016680467 6:146823435-146823457 CTGCCTCCCCATGAATTTGGAGG - Intergenic
1016680571 6:146824573-146824595 CTGCCTCCCCATGAATTTGGAGG + Intergenic
1017978103 6:159375485-159375507 TGTCCTCCCCACGACTCTGGAGG - Intergenic
1018619272 6:165714762-165714784 CCTCCTGCCTGAGACTCTGGGGG - Intronic
1018713519 6:166514458-166514480 CCTCCTGCCCAAGCACCTGGAGG - Intronic
1018891408 6:167985833-167985855 CCCCCTTCCTAAGAAACTGGTGG + Intergenic
1019100107 6:169623330-169623352 CAGTCTCCCCAGGAATCTGGGGG - Intronic
1020354483 7:7261800-7261822 CAGCCTCCCCAAAAATTTGGAGG + Intergenic
1021998256 7:26201368-26201390 CCCCCTCCCCCAGCGTCTGGAGG + Exonic
1023149989 7:37193216-37193238 CCCCCTCACCAAGAATCCAGGGG - Intronic
1023382917 7:39625836-39625858 TCTCCTCTCCAAGTATGTGGTGG + Intronic
1024557152 7:50613567-50613589 TCTCCCTCCCAAGAATCTGGAGG + Intronic
1026519224 7:71102068-71102090 CCATCTCCTCAAGAATTTGGAGG + Intergenic
1026975554 7:74495624-74495646 CCTCCTCCTCCAGGATGTGGAGG - Intronic
1028484289 7:91341191-91341213 GCTCCTCCCTTAGATTCTGGTGG - Intergenic
1029030530 7:97461870-97461892 CAACCTCCCTAAGAATTTGGAGG + Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1031636977 7:124113267-124113289 CCACCTCCCACAGAGTCTGGGGG + Intergenic
1031998122 7:128246234-128246256 CTACCTCCCTAAGAAGCTGGTGG - Intronic
1032356725 7:131217980-131218002 CCGCCTCCCCAAGAATGTGAGGG + Intronic
1032800528 7:135314059-135314081 TCTCCCCCTCTAGAATCTGGAGG + Intergenic
1032823232 7:135543963-135543985 CCTCCTACTAAAGAATATGGGGG - Intergenic
1033686687 7:143646907-143646929 CCCCCTCCGCAGGAATCTGTAGG + Intronic
1033689047 7:143720400-143720422 CCCCCTCCGCAGGAATCTGTAGG - Exonic
1033697922 7:143810707-143810729 CCCCCTCCGCAGGAATCTGTAGG - Intergenic
1036563276 8:9915974-9915996 ACTTCTCCCCATAAATCTGGGGG + Intergenic
1038141252 8:24847888-24847910 GCTCCTCCTCAAGGATTTGGTGG - Intergenic
1040679817 8:49795460-49795482 CCACCTCCCTAAGAATTTGCAGG + Intergenic
1041147403 8:54891490-54891512 CCTACTCCCAATGACTCTGGCGG - Intergenic
1043516794 8:81002038-81002060 CCTCCTTCCAAGGTATCTGGAGG + Intronic
1045511027 8:102812135-102812157 CCTCTTTAACAAGAATCTGGAGG + Intergenic
1047255557 8:123210948-123210970 CTTCCTCCCCTACATTCTGGAGG - Intergenic
1049092198 8:140524699-140524721 CCTCTGTCCCAAGAAGCTGGTGG - Intergenic
1050038659 9:1464171-1464193 CTTCCTTCCAAAGAATCTGCTGG - Intergenic
1050189534 9:3010296-3010318 TCCCGTCCCCAAGAATCTTGTGG + Intergenic
1051367114 9:16329045-16329067 GCCCCACCCCAAGAATCAGGAGG - Intergenic
1051706758 9:19888960-19888982 CCTTCTCCTGGAGAATCTGGTGG + Intergenic
1054711475 9:68515355-68515377 CCTCCTCCGTAAGACTCAGGTGG + Intronic
1061010821 9:127953677-127953699 CCTCCTCCCCTCAGATCTGGGGG - Intronic
1061449428 9:130660437-130660459 CCTCCTCCCGAAACATCTGCCGG - Intergenic
1061728453 9:132594733-132594755 CCACGTCCCCAAGAATCAGAGGG - Exonic
1187099008 X:16172806-16172828 CCTCATCCCCAAGGAACTGGTGG - Intergenic
1188783214 X:34310535-34310557 CCTGTTCCCCAATAATCTAGGGG - Intergenic
1188907000 X:35801533-35801555 CCACCTCCTCAAGACCCTGGAGG - Intronic
1190047113 X:47121271-47121293 TCTCCTCTCCTAGATTCTGGTGG + Intergenic
1191706193 X:64096990-64097012 TCCCCTCCCCAAGAATCAGGAGG + Intergenic
1193335960 X:80289499-80289521 ACGCCTCCTCAGGAATCTGGGGG + Intergenic
1194561414 X:95426778-95426800 TTTCTTCTCCAAGAATCTGGTGG - Intergenic
1195113263 X:101668812-101668834 CATGCTCCAAAAGAATCTGGAGG - Intergenic