ID: 1089613000

View in Genome Browser
Species Human (GRCh38)
Location 11:119679974-119679996
Sequence TGTGAACTCCTCCAAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089612993_1089613000 23 Left 1089612993 11:119679928-119679950 CCTGCCTTGGAAGGTGGTGGTTA 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG 0: 1
1: 0
2: 4
3: 22
4: 211
1089612994_1089613000 19 Left 1089612994 11:119679932-119679954 CCTTGGAAGGTGGTGGTTACACA 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG 0: 1
1: 0
2: 4
3: 22
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089613000 Original CRISPR TGTGAACTCCTCCAAGGGCA GGG Intronic
903460532 1:23517498-23517520 CGTGAACTCCTCCAAGGGTGGGG + Intronic
903551045 1:24157492-24157514 TGTGGACTCCTCCTGGGACAGGG - Exonic
905452034 1:38063102-38063124 TTTGCACTGCTCCAGGGGCAGGG + Intergenic
905517768 1:38574713-38574735 GGTGGACTGCTCCAAGGGCAAGG - Intergenic
906725410 1:48040756-48040778 TGTGGGCTGCTCCAAGGGCTGGG - Intergenic
907255701 1:53177142-53177164 TGTGATCTCATCCAAGTGCCTGG + Intergenic
907380505 1:54083345-54083367 TGTGAACCCCAGCTAGGGCATGG - Intronic
908774960 1:67630851-67630873 TGTGAATACCTCAAAGAGCAGGG - Intergenic
909540677 1:76788020-76788042 TGTGTATTCCTCCAATGGCAAGG - Intergenic
910657308 1:89632593-89632615 TGGGAACTCCTCCGAAGGCCAGG - Intergenic
910723434 1:90312884-90312906 TGTAAACTCCCCTGAGGGCAGGG + Intergenic
911628721 1:100157982-100158004 TGTGATCTCCTTGAAGGCCAGGG - Intronic
912120490 1:106465960-106465982 TCTGTATTCTTCCAAGGGCAGGG + Intergenic
914790966 1:150876823-150876845 TGCCAAATCGTCCAAGGGCAGGG + Intergenic
915863913 1:159477775-159477797 TGTTAACACCTCCAAGTCCATGG + Intergenic
917205775 1:172570884-172570906 TGTGACCTCCTCAAAAGGAAAGG - Intronic
917442246 1:175078324-175078346 TGTAAATTCCTCTAAGGGCCAGG - Intronic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
919679791 1:200423105-200423127 TGTGAGCTCCATCAAGGGCAAGG - Intergenic
919897748 1:202019751-202019773 GGTGCAGTCCTCCAAGCGCAGGG + Intergenic
920760340 1:208777818-208777840 TGTAAACTCCTCCAAAAGAACGG - Intergenic
921174506 1:212582437-212582459 TCAGAACTTCTCCAAGGGGAGGG + Intronic
921639206 1:217532125-217532147 TGTGAGCAACTCCAAGTGCAGGG + Intronic
921820908 1:219616369-219616391 TGTGAACTCTTCTAAGTTCATGG - Intergenic
922453515 1:225755793-225755815 TGCAAACACATCCAAGGGCAGGG - Intergenic
922736147 1:227980369-227980391 CGTGAACTCCTAGCAGGGCATGG + Intergenic
923251051 1:232180093-232180115 AGGGAACTCCTCCCAGGGAAAGG + Intergenic
923395447 1:233557548-233557570 TGTGAAATTCTCCAAAGGGAGGG - Intergenic
923747550 1:236716561-236716583 TGTGATCCCTTCCAAAGGCAGGG + Intronic
1063129895 10:3169209-3169231 TGTGAAATCCTGCAAAGGCCAGG - Intronic
1064211016 10:13360497-13360519 ATTGAACTCTTCCAAGGGCAAGG + Intergenic
1064469512 10:15621644-15621666 AGTGAACCCCTCCTAGGGAACGG + Intronic
1065974402 10:30829732-30829754 TGAGTACTCCTCCATGGTCAAGG - Intronic
1066454270 10:35559726-35559748 TGTGATATCCTCCAAGGAAAGGG + Intronic
1067757263 10:49014694-49014716 TGTGAACTCTGCAGAGGGCAGGG - Exonic
1069718108 10:70533717-70533739 TTTGAGCTCCTCCAAGGCCTGGG + Intronic
1073543051 10:104327947-104327969 TGTGAGCTCCTCCAGGGCAAGGG + Intronic
1074748022 10:116554849-116554871 TGTGAACTCCCACAAGGGCAAGG - Intronic
1074906585 10:117869554-117869576 TGTGAACTCCTCAGAAGGAAGGG + Intergenic
1076344184 10:129769128-129769150 TTTGTACTGCACCAAGGGCATGG - Intergenic
1076588462 10:131567321-131567343 TGTGGACTCCTCCAGGTGCAGGG - Intergenic
1077358168 11:2128128-2128150 TGAGAACCACTCCAAGGGAAGGG - Intergenic
1078002258 11:7506694-7506716 TTTGAACTCATCCTAGGCCAGGG + Intronic
1078021257 11:7657495-7657517 CCTGAGCTGCTCCAAGGGCAAGG - Intergenic
1080341292 11:31268376-31268398 TGTGAACTCCTACAGCGGGAGGG - Intronic
1080987775 11:37491352-37491374 TGGGAACTCTTCCAAGTGCTTGG - Intergenic
1081739588 11:45429092-45429114 CTTGAACTCCTCCAGGGACAAGG - Intergenic
1082791173 11:57347649-57347671 TGGGAACTCCTCTGGGGGCAGGG - Intronic
1086158431 11:83694186-83694208 TTTGAAGTCCTTGAAGGGCATGG - Intronic
1086523291 11:87696935-87696957 TGTGCTCTCCTCCAAGGCCCAGG - Intergenic
1089271513 11:117304808-117304830 TATGAGCTCCACCAAGGGTAGGG + Intronic
1089392850 11:118113819-118113841 TTTGCTCTCCTCCAGGGGCAGGG + Intronic
1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG + Intronic
1091006668 11:131960058-131960080 TTTGAATTCCTTCCAGGGCAAGG + Intronic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1095094490 12:38138442-38138464 TGGGAACTCCTCCAGGGGCTGGG + Intergenic
1095788956 12:46143439-46143461 TGTGAGCTGCTCCAAGGGAGGGG - Intergenic
1096488511 12:52000417-52000439 TATAAACTCCTTGAAGGGCAGGG - Intergenic
1096615104 12:52827872-52827894 TGTGATCTCCAACAAGGCCAAGG - Intronic
1097365728 12:58710140-58710162 TGTGAAAGGCTCCATGGGCATGG + Intronic
1098404375 12:70108618-70108640 TGTGAAGTCTTCCAAAGGCTAGG - Intergenic
1100605105 12:96145728-96145750 TGTAGACTCCTCCGAGGCCATGG - Intergenic
1101615788 12:106335506-106335528 TGTAAACTCCTTGCAGGGCATGG + Intronic
1101931858 12:109021130-109021152 TGTGAACTCTTCCAAGCAGAAGG - Intronic
1102488921 12:113277137-113277159 TGTTCATTCTTCCAAGGGCAGGG - Intronic
1103523153 12:121549588-121549610 TGTGAACACCCAGAAGGGCACGG - Exonic
1103670349 12:122609629-122609651 TCTGAACTCCTGCGAGGGCGAGG + Intronic
1106200790 13:27535495-27535517 TGTGGACTTCCCAAAGGGCAGGG + Intergenic
1107323708 13:39216859-39216881 TTTGAAGTCCTAAAAGGGCAGGG - Intergenic
1110030849 13:70611277-70611299 TTTGAACACCGCTAAGGGCAGGG - Intergenic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1111794426 13:92899716-92899738 TGAGAACTCCTAGAAGGGGAAGG + Intergenic
1111815511 13:93147863-93147885 TGGGAAATCATCCAAGGACAAGG - Intergenic
1113162036 13:107392530-107392552 TGTAAACATTTCCAAGGGCAAGG + Intronic
1113290392 13:108899644-108899666 GGTGTGCTCCTCCAAGGGAAGGG + Intronic
1113777185 13:112954500-112954522 TATGAACTCCACTAAGGCCAAGG - Intronic
1114735602 14:25040769-25040791 TGTGAACTCCTTCAAAGACAAGG - Intronic
1114815657 14:25954974-25954996 TGGGGACTCCTCCATGGTCAAGG - Intergenic
1117437602 14:55731838-55731860 TGGGAACTCATGCAAAGGCAAGG + Intergenic
1119029848 14:71183414-71183436 AGTAAACTCCTCAGAGGGCAAGG - Intergenic
1119484788 14:74980348-74980370 TGTGACCCCCTCCAAGGTCTGGG - Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1123579678 15:21704522-21704544 GGTGTGCTCCTCCAAGGGAAGGG - Intergenic
1123616305 15:22147033-22147055 GGTGTGCTCCTCCAAGGGAAGGG - Intergenic
1125594653 15:40876804-40876826 TGCAAACTCCTTCTAGGGCAAGG - Intergenic
1127818666 15:62635940-62635962 TGTGAACTCGACCAAGGCCACGG - Intronic
1128079047 15:64845418-64845440 TGTGAACCCTGCCAAGGGGAGGG + Intronic
1129785345 15:78306516-78306538 TTTGAATACCTCCAAGGACAGGG + Intergenic
1202988548 15_KI270727v1_random:438767-438789 GGTGTGCTCCTCCAAGGGAAGGG - Intergenic
1132693174 16:1190714-1190736 AGAGAGCTCCTCCAATGGCAAGG - Intronic
1132956482 16:2596982-2597004 TGTGCACTCACCCAGGGGCAGGG - Intronic
1132986476 16:2770108-2770130 ACTGAGCTCCTTCAAGGGCAGGG + Intronic
1133483990 16:6200672-6200694 TGTGAACTTCTTCAAGGTAAAGG - Intronic
1134864843 16:17596579-17596601 TGTTAACTCCTTCAAGACCAAGG + Intergenic
1135396630 16:22136607-22136629 TGTGGACTCCTGGGAGGGCAGGG + Intronic
1136137056 16:28262550-28262572 TGTGAGCCCCTCCAGGGACATGG - Intergenic
1137522156 16:49203611-49203633 TGTGATCCCCTCCCAGGGAAGGG - Intergenic
1137586695 16:49668157-49668179 GGTGAACTCCTGCAAGGAAAAGG - Intronic
1141015738 16:80447471-80447493 TATGTCCTCTTCCAAGGGCAAGG - Intergenic
1141116176 16:81311806-81311828 TGTGAGCTCCTCCAAGGCAGGGG - Intergenic
1141297216 16:82781356-82781378 TGTGAACTTATACAAGGGCTTGG + Intronic
1203088989 16_KI270728v1_random:1201201-1201223 TATGTACTCCTCCAAAGCCATGG + Intergenic
1142750200 17:1982910-1982932 TGTGAGCTCCTTGAAGGGCTGGG + Intronic
1145371545 17:22310732-22310754 TCTGAACTGCTCTAAGGGAATGG - Intergenic
1146047595 17:29522777-29522799 TTTAAACTTATCCAAGGGCAGGG + Intronic
1146664870 17:34692704-34692726 TGTGACCTCCTGCAAGTGCCTGG - Intergenic
1146747747 17:35346786-35346808 GGTGACCCCCTCCCAGGGCAGGG - Intergenic
1147808081 17:43146749-43146771 TGTGTTCTCCTCCTAGGGCAGGG + Intergenic
1148279601 17:46337713-46337735 TGTGTTCTCCTCCTATGGCAGGG - Exonic
1148301818 17:46555569-46555591 TGTGTTCTCCTCCTATGGCAGGG - Exonic
1149444864 17:56705576-56705598 TGTTAACACATCCAAGGGGAGGG + Intergenic
1149639790 17:58195204-58195226 TGTGGCCTCCCCCAAAGGCAAGG + Intronic
1149982736 17:61324135-61324157 TGCAAACTCCTCCAGAGGCAGGG + Intronic
1151321570 17:73355693-73355715 TGTGAAATCCCTCAAGGGCAAGG + Intronic
1151363199 17:73600806-73600828 TCTGAGCTGCTCCAAGGACAGGG - Intronic
1155078800 18:22387364-22387386 TATGAACTCATTTAAGGGCAAGG + Intergenic
1155451179 18:25964156-25964178 TGACATCTCCTCCAGGGGCATGG + Intergenic
1156133474 18:34006826-34006848 TGTGAATACCTCGAAGGGCTGGG + Intronic
1157409495 18:47451933-47451955 AGTGAACTCCTTACAGGGCAGGG + Intergenic
1157782111 18:50448819-50448841 TGGGAAATCCTCCAAAGGAAGGG + Intergenic
1159912163 18:74155994-74156016 TGTCCACTCCTCCCAGGGAAGGG - Intronic
1160982319 19:1822078-1822100 TGTGACTTCATCAAAGGGCAAGG - Intronic
1167111717 19:47466374-47466396 TGTGACCCCCACCAAGGCCAGGG + Exonic
1167506676 19:49874532-49874554 TGTGAATTCCCCCAAGGTCAGGG + Intronic
1168095869 19:54114667-54114689 TGAGAACTCCTCAAAGCCCACGG + Exonic
925167784 2:1729011-1729033 TGTGAGCTCCTCCCAGTGCGGGG + Intronic
926151994 2:10430373-10430395 TGTGAGCTCCTTGTAGGGCAGGG - Intergenic
929046288 2:37793848-37793870 TGAGCACTCCTCCATGGGTAGGG - Intergenic
931642694 2:64395779-64395801 TGTGCATGCTTCCAAGGGCAGGG - Intergenic
932349809 2:71022757-71022779 TGTGACCTCCTACAAAGGCTTGG - Intergenic
932958085 2:76379455-76379477 TGTAAATACATCCAAGGGCAGGG + Intergenic
935106861 2:100052781-100052803 TGAGGACTCCTGCAGGGGCAGGG + Intronic
935206589 2:100901717-100901739 TGTGAACACCTGTAAGGGGAAGG - Intronic
935427318 2:102933811-102933833 CCTGAACACCTCCAAGGACAGGG + Intergenic
935700429 2:105807303-105807325 GGTGCTCTCCTCGAAGGGCAGGG + Intronic
937064973 2:119011070-119011092 TGTGAACTCCTACCAGGCCCAGG + Intergenic
938292437 2:130157253-130157275 TTTGAACTCCTCCAGGGGGCTGG + Exonic
938464117 2:131515723-131515745 TTTGAACTCCTCCAGGGGGCTGG - Intergenic
939993002 2:148893651-148893673 TGTGAGCTCCTCTCAGGTCAGGG + Intronic
940263620 2:151812817-151812839 TCTGAACACCTAAAAGGGCACGG + Intronic
940569251 2:155409496-155409518 GGTGCACAGCTCCAAGGGCATGG - Intergenic
944323616 2:198377401-198377423 TGTGTACGCCCCAAAGGGCAGGG + Intronic
945051355 2:205827205-205827227 TGTTAACACCTCCAAGGCCAAGG + Intergenic
946091830 2:217232855-217232877 TGTCATCTTATCCAAGGGCATGG + Intergenic
947951983 2:234156060-234156082 TGTTAATTCCTCCCAGGTCATGG - Intergenic
1169153305 20:3307515-3307537 TGTGAACCCCTGCAAAGGTATGG - Intronic
1169343038 20:4810603-4810625 TGGGAAGTCCTCCAAGGGAGGGG + Intronic
1173249293 20:41356188-41356210 CTTGAATACCTCCAAGGGCAGGG + Intronic
1174097124 20:48098271-48098293 TCTGGAGTCCTCAAAGGGCAAGG + Intergenic
1175768551 20:61608000-61608022 TGTGAAATCTAACAAGGGCAGGG - Intronic
1176871173 21:14084310-14084332 TGGGAACTCCTCCAGGGGCTGGG - Intergenic
1179590572 21:42405368-42405390 CGTGGACTCCTTCAAAGGCATGG - Intronic
1179979874 21:44890301-44890323 GGTGTTCTCCACCAAGGGCAAGG - Intronic
1181677648 22:24467149-24467171 TGTGACCTCCTGCAGGGGCTTGG + Intergenic
1181932313 22:26412121-26412143 TGTGAACTCCTCCGAGAGCAGGG + Intergenic
1183055953 22:35305709-35305731 TGTGCAGGGCTCCAAGGGCATGG + Intronic
1183469563 22:37998308-37998330 TGTTAACTCCCTCAAGGCCAGGG + Intronic
1184303725 22:43580043-43580065 TGTGAAGTCCTCCAGGAGCAAGG - Intronic
1184369087 22:44071134-44071156 TGTGAGATTCTCCAAGGGGAGGG - Intronic
1184879133 22:47294075-47294097 TGTGACTGCCTCCAGGGGCACGG + Intergenic
1185330989 22:50251940-50251962 TGTGAACTCCCGCGGGGGCAGGG - Intronic
950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG + Intergenic
952878812 3:37970217-37970239 GGTGAACTCCTTCAAGGTCCAGG + Intronic
953198283 3:40754323-40754345 TGTTAGCTCCTCCATGGGCAGGG + Intergenic
953319915 3:41962343-41962365 TGTGGGCTCGTCCAAAGGCAGGG - Exonic
955067161 3:55543541-55543563 TGTGGTCTTCTCCAAGGGAAGGG - Intronic
957044526 3:75363559-75363581 TGTGACCTCCTACAAAGGCTTGG + Intergenic
962024110 3:131529055-131529077 TGTGAGCTCCTCCAGGAGCAGGG + Intergenic
962042213 3:131719176-131719198 TGAGAACTCCTTCAAGATCATGG - Intronic
965656823 3:170995397-170995419 TGTGAACTCCTTGAAGTGTAGGG + Intergenic
967136363 3:186516031-186516053 TGAGAATTTCACCAAGGGCAGGG - Intergenic
969170192 4:5356076-5356098 TGTGACCACCTCCCTGGGCAGGG + Intronic
970192702 4:13530660-13530682 AGGGAACTCCTCCAAGGGTCTGG + Intergenic
972159532 4:36206219-36206241 TCTGAACTCCTCCCAGGTCTTGG + Intronic
972721009 4:41698359-41698381 TCTAAACTTCTCCATGGGCAAGG - Exonic
973813072 4:54592039-54592061 TGTTAATTCCTCCAAGGGCAGGG - Intergenic
975478217 4:74847060-74847082 TGAGAACTCCTCAAAAGGAAAGG + Intergenic
978690725 4:111506047-111506069 TGTGTAGTCCTCCATAGGCATGG + Intergenic
980106999 4:128597679-128597701 TGGGATCTTCTTCAAGGGCAGGG + Intergenic
981151857 4:141387902-141387924 TGTGAATTCCTTTTAGGGCATGG + Intergenic
984951961 4:185014672-185014694 TGTGAACTCCTCCAGGGCTGAGG - Intergenic
987432860 5:17857844-17857866 TGAGAACAGCACCAAGGGCATGG - Intergenic
990991539 5:61689213-61689235 TGTGACATCCTTCAAGGGCTTGG + Intronic
992552064 5:77868407-77868429 TGTGAATTCCTCCCTGTGCATGG - Intronic
993100946 5:83538996-83539018 TGTAAACTCTTCCCAGGGGAAGG - Exonic
996783394 5:127212939-127212961 TTTGAACTCCACCAGAGGCATGG + Intergenic
997354635 5:133254459-133254481 TGTGGCCACCTCCAGGGGCAGGG + Intronic
999153424 5:149441730-149441752 TTTAAACTCAACCAAGGGCAGGG + Intergenic
1000220382 5:159209059-159209081 TGTGGACTCCTCCAATGCTAGGG + Intronic
1001133086 5:169080422-169080444 TATGATCTCCTCCACGGCCAAGG + Intronic
1001751695 5:174136349-174136371 GGTGAGCTCGTCCAAGAGCAAGG + Intronic
1002370090 5:178745108-178745130 TTTGAACTCCACCAGAGGCATGG - Intergenic
1002876782 6:1217760-1217782 GGGGAAGTCCTCCAAGGGCCAGG + Intergenic
1003258733 6:4496801-4496823 TGTGAGCTCCTCGAAGGCCAGGG - Intergenic
1004156175 6:13170395-13170417 TGTGAACTCATGGCAGGGCAGGG + Intronic
1007271741 6:40642673-40642695 TGTGAACACCACTAAGGACAGGG - Intergenic
1007547467 6:42705127-42705149 GGTGGAGTCCTCCGAGGGCAAGG - Intronic
1007915985 6:45562305-45562327 TGTGAAGTCCTCTAGGGGCATGG - Intronic
1008898214 6:56581747-56581769 TGTGAACTCATCCTTGGCCATGG + Intronic
1011273723 6:85606447-85606469 TGGAAGCTCCTCGAAGGGCAGGG - Intronic
1011666972 6:89643727-89643749 TATGACCTCCTCCCAGGCCAGGG + Exonic
1012666065 6:101971750-101971772 TGTGAACTACTAGAAGGGGAAGG - Intronic
1016907959 6:149169895-149169917 TGTGCCCTCCTAAAAGGGCAGGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1028025526 7:85833219-85833241 TGTGAACTCCTCCAGTGCAAAGG - Intergenic
1028718982 7:94007507-94007529 TGTGAACTCACTCAAGGGGATGG - Intergenic
1033543766 7:142381340-142381362 TGAGAACTCTGCCAAGGACATGG - Intergenic
1036503888 8:9337634-9337656 TGTGAAGTCCTCAGAGAGCAGGG + Intergenic
1036642768 8:10594361-10594383 GGAGAGCTCCTCCAAGGGAAGGG - Intergenic
1037551911 8:19982694-19982716 TGAGAACACATCCAAGGACATGG - Intergenic
1038020773 8:23550504-23550526 TGTGGCCTCCGCCAAGGGCGTGG + Intronic
1038435766 8:27534950-27534972 TGTGACCTTCACCAAGAGCATGG - Intronic
1040284147 8:46091518-46091540 TCTGAGGTCCTCCATGGGCAAGG + Intergenic
1041242757 8:55862335-55862357 TGGGAACTTCTCCAAGGAGAAGG - Intergenic
1042561724 8:70076853-70076875 CTTGAACCCCTCCAAGGTCATGG + Intergenic
1043469251 8:80545680-80545702 TGTGAACTCCTTAAATGACAGGG + Intergenic
1044321765 8:90810043-90810065 AGGGAACTCGTCCAAGGGCATGG + Intronic
1045860643 8:106811801-106811823 TGTTAACACCTTGAAGGGCAGGG + Intergenic
1046979916 8:120326115-120326137 AGTCAACTCTTCAAAGGGCAGGG - Intronic
1048452700 8:134548054-134548076 TCTGAGCTCCTTCAAGGGCTTGG - Intronic
1048977382 8:139680509-139680531 TCTGATCTCCTCCATGGGTAAGG - Intronic
1051905365 9:22088849-22088871 TGTGAACTCCACCCAGGCCTGGG - Intergenic
1052973654 9:34396816-34396838 TGTGAGCTCCTCAAAGGCAAGGG + Intronic
1053397658 9:37788777-37788799 AGTGAACTCCCCCAAGGGCAGGG - Intronic
1056869883 9:90267728-90267750 TGTGGTCTCCTACAAGGGGAAGG - Intergenic
1057483093 9:95461118-95461140 TTTGGACTCCTCCAATTGCACGG - Intronic
1057822290 9:98342031-98342053 TGTGACCTCCTCAAAGGCCATGG - Intronic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1059667632 9:116463766-116463788 TGTGAGCTCCTGAAAGGCCAGGG + Intronic
1061071536 9:128313881-128313903 TGTGTAATCCTTCAAGGACAGGG + Exonic
1189285448 X:39849105-39849127 TGTGAGCTCCACGAAGGGCAAGG + Intergenic
1195462645 X:105144968-105144990 TGTGAGCTTCTCTAAAGGCAAGG + Intronic
1200000301 X:153056622-153056644 TGTTACCTTCTCCCAGGGCAAGG - Intronic
1202260534 Y:22965791-22965813 TATAAACTCCTTCAAAGGCAGGG - Intergenic
1202382212 Y:24283380-24283402 TGTGAACTCCTAGCAGGGCGTGG + Intergenic
1202413521 Y:24599532-24599554 TATAAACTCCTTCAAAGGCAGGG - Intergenic
1202457261 Y:25070536-25070558 TATAAACTCCTTCAAAGGCAGGG + Intergenic
1202488572 Y:25386745-25386767 TGTGAACTCCTAGCAGGGCGTGG - Intergenic