ID: 1089613183

View in Genome Browser
Species Human (GRCh38)
Location 11:119681017-119681039
Sequence CCGAGTCCCAGTGGTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 176}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089613173_1089613183 15 Left 1089613173 11:119680979-119681001 CCCTAGCTTCCTCCTCTGTAAGG 0: 1
1: 1
2: 20
3: 254
4: 1833
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613175_1089613183 14 Left 1089613175 11:119680980-119681002 CCTAGCTTCCTCCTCTGTAAGGC 0: 1
1: 1
2: 4
3: 53
4: 474
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613172_1089613183 25 Left 1089613172 11:119680969-119680991 CCTTTCTGAGCCCTAGCTTCCTC 0: 1
1: 1
2: 52
3: 353
4: 2074
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613171_1089613183 26 Left 1089613171 11:119680968-119680990 CCCTTTCTGAGCCCTAGCTTCCT 0: 1
1: 0
2: 16
3: 137
4: 803
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613170_1089613183 27 Left 1089613170 11:119680967-119680989 CCCCTTTCTGAGCCCTAGCTTCC 0: 1
1: 0
2: 11
3: 77
4: 576
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613169_1089613183 30 Left 1089613169 11:119680964-119680986 CCTCCCCTTTCTGAGCCCTAGCT 0: 1
1: 0
2: 0
3: 31
4: 339
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613178_1089613183 3 Left 1089613178 11:119680991-119681013 CCTCTGTAAGGCAGCAGACTGGC 0: 1
1: 0
2: 0
3: 5
4: 145
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176
1089613176_1089613183 6 Left 1089613176 11:119680988-119681010 CCTCCTCTGTAAGGCAGCAGACT 0: 1
1: 0
2: 4
3: 19
4: 204
Right 1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089613183 Original CRISPR CCGAGTCCCAGTGGTCCTCC TGG Intronic
900343058 1:2197676-2197698 ACGTGTCACAGTTGTCCTCCTGG + Intronic
900680048 1:3911668-3911690 CCAAGTCCCGCTGGGCCTCCTGG - Intergenic
901219457 1:7574904-7574926 CCCAGTCCCAGAGCTCCACCAGG + Intronic
903246294 1:22018113-22018135 CCGGGTTCCAGTGATTCTCCTGG + Intergenic
905518546 1:38579899-38579921 ACGATTCCCAGTTCTCCTCCTGG - Intergenic
905581259 1:39084103-39084125 CCAAGTCCCAGTGTTCCTTATGG + Intronic
905806644 1:40881988-40882010 CCGGGTTCAAGTGATCCTCCTGG - Intergenic
908708743 1:66991375-66991397 CTGAGTCCCAGTTGCCCTCTGGG + Intergenic
912432838 1:109638474-109638496 CTGAATCCCAGTGCACCTCCTGG + Intergenic
913546128 1:119871047-119871069 CAGAGCCCTAGGGGTCCTCCTGG - Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
916713638 1:167432835-167432857 CCAAGTCCCAGCTGTGCTCCAGG + Intronic
918646840 1:186915689-186915711 TCCAGTCCCAGTGGGACTCCGGG + Intronic
922690434 1:227684909-227684931 TCCAGTCCCAGTGGGACTCCAGG - Intergenic
923457295 1:234175567-234175589 CTGAGCCCAAGTGCTCCTCCTGG - Intronic
1062784613 10:252416-252438 CCGCGTGCCAGTGCTCCTGCTGG - Exonic
1062872976 10:922571-922593 CTGAGCTCCAGTGATCCTCCTGG - Intronic
1070891168 10:79943004-79943026 CCCAGGCCCAGTGGTGATCCAGG + Intronic
1072335145 10:94391274-94391296 TCTAGTCCCAGTGGGACTCCGGG - Intergenic
1075728187 10:124621230-124621252 CCCACGCCCAGTGGTACTCCGGG + Exonic
1076614430 10:131746616-131746638 CCGCGTCCCAGTGGGGTTCCGGG - Intergenic
1076635068 10:131876350-131876372 CAGAGTCCCAGTGACACTCCTGG - Intergenic
1077102013 11:826615-826637 CCGAGTTCAAGTGATTCTCCTGG + Intronic
1077173585 11:1178979-1179001 CCGAGTTCCAGTGGAGCTCAGGG - Intronic
1082816920 11:57515165-57515187 CAGAGTTCCAGCGGACCTCCTGG - Intronic
1083070548 11:59975372-59975394 CTGAGTTCCAGTGATTCTCCTGG + Intergenic
1084476799 11:69393990-69394012 CCGATCCCCAGTGGGCCTCAAGG + Intergenic
1084724812 11:70934535-70934557 CTGAGACCCAGTGGCCTTCCTGG - Intronic
1084905561 11:72343648-72343670 CTGGGTCAAAGTGGTCCTCCTGG - Intronic
1085512390 11:77095044-77095066 CCTAGCCCCAGTAGTCCTGCAGG + Intronic
1089195939 11:116694051-116694073 CCGCCTCTCAGTGCTCCTCCAGG + Intergenic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1090468797 11:126959794-126959816 CTGAATCCCATTAGTCCTCCAGG + Intronic
1090882831 11:130849188-130849210 CCTAATTCCAGTGGTCCTCTTGG + Intergenic
1091225842 11:133956219-133956241 GCCAGTCCCAGGGATCCTCCGGG + Intronic
1094199303 12:27780360-27780382 CCGGGTAGCAGCGGTCCTCCAGG - Exonic
1095985292 12:47995280-47995302 ATGGGTCCCCGTGGTCCTCCTGG - Exonic
1096251476 12:50035745-50035767 CCGAGTTCAAGTGATTCTCCTGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096912306 12:54996646-54996668 CTGACTCCCAGTGGTTCTCAAGG + Intergenic
1098248735 12:68546637-68546659 TCCAGTCCCAGTGGGACTCCAGG - Intergenic
1101789019 12:107911470-107911492 CCCAGGCCCAGTAGCCCTCCTGG - Intergenic
1103506566 12:121445152-121445174 CCCAGACTCAGGGGTCCTCCAGG + Intronic
1104673311 12:130695291-130695313 CTGAGGCCACGTGGTCCTCCTGG - Intronic
1104735312 12:131132668-131132690 CTGAGTCCCCATCGTCCTCCAGG - Intronic
1104773509 12:131379351-131379373 CCGAGCCCCAGAGTTCCCCCGGG + Intergenic
1104964868 12:132504421-132504443 CCCAGCCCTGGTGGTCCTCCTGG + Intronic
1104979680 12:132568212-132568234 CCGAGACCCCGTGGCCCTGCCGG - Intronic
1105437447 13:20390809-20390831 CCGAGGCCCAGTTGTGGTCCTGG + Intergenic
1105625223 13:22106307-22106329 CCTAGCCCCAGTCCTCCTCCTGG - Intergenic
1110273366 13:73616084-73616106 CTGAGTCGCTGAGGTCCTCCAGG - Intergenic
1110524678 13:76522187-76522209 CCCAGTGCCTGTGGGCCTCCAGG + Intergenic
1112971380 13:105267061-105267083 CTGAGTCCCAGGGCTCCTCTGGG + Intergenic
1113494085 13:110714120-110714142 CCGAGTCGCCGGGGACCTCCGGG + Intronic
1113855014 13:113438750-113438772 CTGGGTCCAAGTGATCCTCCTGG + Intronic
1113882109 13:113632928-113632950 CCCAGGCCCAGTGGTCCTGCAGG - Intronic
1121319209 14:92981322-92981344 CCGAGGCCCAGAGGGCCTCCAGG - Intronic
1121359734 14:93245734-93245756 CTGAGTCCCAGTGGGGCTCTTGG + Intronic
1122942708 14:104989538-104989560 CCCAGCCCCAGGGGTGCTCCCGG + Intronic
1123068674 14:105630528-105630550 CCGAGTTGCAGTGGGACTCCAGG + Intergenic
1123072671 14:105649330-105649352 CCGAGTTGCAGTGGCACTCCAGG + Intergenic
1123092698 14:105748855-105748877 CCGAGTTGCAGTGGGACTCCAGG + Intergenic
1123995306 15:25713980-25714002 CCGAGGCCCAGTTGTCCGCCTGG + Exonic
1127313156 15:57770214-57770236 CCAACTCCCACTGGTCCTCTGGG + Intronic
1132553802 16:564163-564185 CGGAGTCCCAGAGGGGCTCCTGG - Exonic
1132674656 16:1116733-1116755 CCAGGCCCCAGAGGTCCTCCCGG + Intergenic
1132772858 16:1574204-1574226 CCCAGGCCCAGTGTTCCTCGGGG + Intronic
1132815601 16:1824964-1824986 CCGAGTGCCGGGCGTCCTCCTGG + Intronic
1132849207 16:2016866-2016888 TCTGGTCCCCGTGGTCCTCCAGG + Intronic
1135193958 16:20379265-20379287 CCGGGTTCCAGTGATTCTCCTGG + Intronic
1135582653 16:23641422-23641444 ATGAGTCCCAGTGGGCCACCTGG + Exonic
1135997107 16:27258842-27258864 CCGGGTTCCAGTGATTCTCCTGG + Intronic
1139277526 16:65741656-65741678 CCAAGTCCTAGTGATTCTCCTGG - Intergenic
1141288914 16:82699320-82699342 CCTACTACCGGTGGTCCTCCTGG - Intronic
1141563702 16:84887137-84887159 CCGAGCCCCAGGGGTCATCGGGG - Intronic
1142247285 16:88975956-88975978 CCGATTCCCAGTGGCCCTCGTGG - Intronic
1144608808 17:16690493-16690515 CCAAGTACCACTGGTCCCCCTGG - Exonic
1144608817 17:16690520-16690542 CCGAGGACCACTGGTCCCCCGGG - Exonic
1144848810 17:18233796-18233818 CCGAGTCACAGTGGTCCTGCTGG + Exonic
1144904013 17:18625333-18625355 CCAAGTACCACTGGTCCTCCTGG + Intergenic
1145128571 17:20321409-20321431 CCAAGTACCACTGGTCCTCCTGG - Intergenic
1145128580 17:20321436-20321458 CCGAGGACCACTGGTCCCCCGGG - Intergenic
1145196048 17:20895906-20895928 CCAAGTACCACTGGTCCTCCTGG + Exonic
1145346701 17:22046485-22046507 CCGGGTCCCAGTGGATCTTCAGG + Intergenic
1146281995 17:31550457-31550479 CCGAGTCCCCGCGGGCCACCTGG - Intergenic
1146897421 17:36554459-36554481 CCGGGTTCAAGTGGTTCTCCTGG + Intronic
1148713515 17:49699174-49699196 CCCAGTCCCTGTGATCCTGCAGG + Intergenic
1148828629 17:50414002-50414024 TCCAGTCCCAGTGGGACTCCGGG + Intergenic
1150733717 17:67717706-67717728 CCGAGTCCCGGATGTGCTCCAGG - Intergenic
1152399663 17:80058214-80058236 CCAAGTCTCAGAGATCCTCCTGG - Intronic
1153337704 18:3941567-3941589 CTGAATCCCAAGGGTCCTCCAGG - Intronic
1153830713 18:8920028-8920050 TCCAGTCCCAGTGGGACTCCAGG - Intergenic
1161596601 19:5154004-5154026 CTGGGTCCCAGTGGCCATCCAGG - Intergenic
1161845992 19:6712349-6712371 CCGAGTCCCCGTGGCAGTCCAGG - Exonic
1162013801 19:7832795-7832817 CCTGTTCCCCGTGGTCCTCCTGG - Intronic
1163409475 19:17144874-17144896 CCGAGTTCAAGCGGTTCTCCTGG - Intronic
1164617372 19:29675100-29675122 CTGAGTCCCAGGAGGCCTCCTGG + Exonic
1165816857 19:38647844-38647866 CCCGGTCCCAGTCGTCCTCCTGG - Exonic
1166996790 19:46723240-46723262 CGGCGTCCCCGTGGCCCTCCAGG + Exonic
1167070969 19:47221766-47221788 CCGAGTCCCTGACGTCCACCGGG + Exonic
1167748625 19:51367271-51367293 CCCAGTCCCCGGGGCCCTCCCGG - Intronic
1168121033 19:54252634-54252656 CTCAGTGCCAGTGGGCCTCCAGG - Intronic
1168335074 19:55592875-55592897 CCGGGCCCGAGTGGGCCTCCAGG + Exonic
928306738 2:30176514-30176536 CCGGCTCCCATTGGTCCTACTGG + Intergenic
930753903 2:54957388-54957410 GTGAGTCCCAGTGGCCCTCTGGG + Intronic
933876915 2:86629302-86629324 CCGGGTTCAAGTGATCCTCCTGG + Intronic
935653062 2:105398794-105398816 CCCTCTCCCAGTGGTCTTCCCGG + Intronic
937067265 2:119026802-119026824 CCAAGTCCCAGAGGTCCAGCTGG - Intergenic
937999254 2:127719557-127719579 CCGTGTCCCAGTAGTCCACCTGG + Exonic
943441063 2:187929470-187929492 CCCAGTCACAGTGGTTATCCTGG - Intergenic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
947165836 2:227261078-227261100 CCAGGTCCCAGTGGTCCCCCCGG + Exonic
947360469 2:229340648-229340670 CCCTGTCCCACTGGCCCTCCAGG - Intergenic
947770629 2:232667459-232667481 CCCAGTTCCAGTCCTCCTCCAGG + Intronic
947906113 2:233764558-233764580 CCGAGTCTAAGTTCTCCTCCAGG - Intronic
948312475 2:236999077-236999099 CCCAGTCCTAGTGGGCCTTCTGG + Intergenic
1169087332 20:2835611-2835633 CTGGGGCCCAGTGGTCCACCGGG - Exonic
1170787715 20:19481958-19481980 CCCAGACCCAGTCTTCCTCCCGG + Intronic
1172205675 20:33161218-33161240 CTGATTCCCATTGGTCCTGCTGG - Intergenic
1172331215 20:34077258-34077280 TCGAGTCCCAGTCGTGCCCCTGG - Intronic
1172562809 20:35904575-35904597 TCGAGTCCCAGTGGTTTTGCTGG - Intronic
1174156818 20:48521167-48521189 CCGGGTCCCAGGGCTTCTCCTGG - Intergenic
1176654795 21:9578555-9578577 TCAAGTCCCAGTGGACGTCCAGG + Intergenic
1178899723 21:36589225-36589247 CCGAGTCCCCTTGGTCCCCAAGG + Intergenic
1179489904 21:41734444-41734466 CCTGGTCCCAGTGGTGCTACTGG - Intergenic
1179659986 21:42868190-42868212 CGGAGGCCCAGGGCTCCTCCAGG - Intronic
1180091373 21:45535255-45535277 CCGAGTCCGTGAGGTGCTCCTGG - Intronic
1180301403 22:11039216-11039238 CCGAGTTCAAGTGATTCTCCTGG - Intergenic
1180685552 22:17663940-17663962 CCGGGTCCAAGTGATCCTCCTGG + Intronic
1181038164 22:20179731-20179753 CCCAGCCCCAGTGACCCTCCAGG + Intergenic
1182061631 22:27402569-27402591 CAGAGTCTCCGTGGTCCTCCTGG - Intergenic
1184812370 22:46844808-46844830 CCCAGGCCCAGGGGTCCTACTGG + Intronic
1184961622 22:47933485-47933507 ACTAGTCCCAGTGGCCCCCCAGG + Intergenic
950070996 3:10152584-10152606 CCGAGTTCAAGTGATTCTCCTGG + Intergenic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
950352963 3:12375156-12375178 CTGCGTTCAAGTGGTCCTCCTGG - Intronic
954509460 3:51109702-51109724 CCAGGTTCCAGTGGTCCACCTGG - Intronic
959260115 3:104067645-104067667 CAGAGTTCCAGGGCTCCTCCTGG + Intergenic
961001226 3:123375426-123375448 CTGGGACCCAGTGGTCCTCAAGG + Intronic
961308289 3:125975070-125975092 CCTGGGCTCAGTGGTCCTCCAGG + Intronic
962374295 3:134847313-134847335 CCTAGTCCCAGCTGTCTTCCTGG - Intronic
962885916 3:139627694-139627716 CCGAATACCTGTGGTGCTCCTGG - Intronic
964932668 3:162045836-162045858 TCCAGTCCCAGTGGGACTCCGGG + Intergenic
966172723 3:177100515-177100537 CTGAGTTCAAGTGGTTCTCCTGG + Intronic
966245321 3:177801745-177801767 CCGGGTTCCAGTGATTCTCCTGG - Intergenic
968909100 4:3467484-3467506 CCAAGTCCCAGGGCTCATCCTGG + Intronic
972517819 4:39825679-39825701 CTGGGTTCAAGTGGTCCTCCAGG + Intronic
976383965 4:84434025-84434047 CCAAGTCCCAGGTGTCCTCCTGG - Intergenic
981034557 4:140156147-140156169 CCGGGTTCCAGTGATTCTCCTGG + Intergenic
983898302 4:173104919-173104941 TCCAGTCCCAGTGGGACTCCGGG - Intergenic
985538212 5:475984-476006 CCCAGTCCCAGCGTTCCTGCAGG + Intronic
986590599 5:9365395-9365417 CCGAGCCCCATTGGGGCTCCAGG - Intronic
991675834 5:69089153-69089175 TCCAGTCCCAGTGGGACTCCAGG + Intergenic
991771788 5:70047950-70047972 CCGAGTTCAAGTGATTCTCCTGG + Intergenic
996846557 5:127905077-127905099 TGTACTCCCAGTGGTCCTCCAGG - Intergenic
999573350 5:152945682-152945704 CCCAGTCCCAGTGGAGCTTCTGG - Intergenic
1000450105 5:161375114-161375136 CTGAGTCCTAGTCGTCTTCCAGG + Intronic
1001269506 5:170300950-170300972 CAGGGTCACAGTGGTCCTTCTGG - Intergenic
1004494083 6:16146957-16146979 CTGCGTCCCAGAGCTCCTCCTGG - Intronic
1007693886 6:43719571-43719593 CGGACACCCAGGGGTCCTCCAGG - Intergenic
1012549661 6:100455368-100455390 CCTGGTCCCTGGGGTCCTCCTGG + Intronic
1014024283 6:116627291-116627313 CCGGGTTCAAGTGATCCTCCTGG + Intronic
1018803187 6:167238919-167238941 CCTGGTCCCAGTGGGCCACCAGG + Intergenic
1018806927 6:167269032-167269054 CCTGGTCCCAGTGGGCCACCAGG - Intergenic
1019268045 7:129854-129876 CCTATTCCCAGTGGAGCTCCGGG - Intergenic
1019298061 7:289623-289645 CTGAGACCCAAGGGTCCTCCCGG + Intergenic
1020372766 7:7452335-7452357 CCAATTCCCACTGGTCCTCGAGG + Exonic
1022442526 7:30446032-30446054 GCGAGCCCCAGTGGTCCTTCTGG + Intronic
1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG + Exonic
1029807338 7:103010682-103010704 CCATGTTCCAGTGGTTCTCCTGG + Intronic
1032013057 7:128359527-128359549 CCAGGTCACAGTGCTCCTCCTGG + Exonic
1032362999 7:131273372-131273394 CACATTCCCAGTGGTCCTCCAGG - Intronic
1032525047 7:132573705-132573727 CAGTGTCCCAGTGGGCATCCAGG + Intronic
1033111083 7:138577462-138577484 CAAAGTCCCAGTGGTCATGCTGG + Exonic
1033579554 7:142719626-142719648 CCGAGTCCCATGAGTCCTTCTGG - Intergenic
1034552128 7:151827842-151827864 CGGAGGCCACGTGGTCCTCCTGG - Intronic
1037829977 8:22181781-22181803 CTGAGTTCAAGTGATCCTCCTGG + Intronic
1039044119 8:33434689-33434711 CTGATTCCAGGTGGTCCTCCTGG - Intronic
1040981851 8:53252252-53252274 CCGGGCCTCAGTGGTGCTCCAGG + Intergenic
1048856513 8:138690828-138690850 CCCGGTCCCAGTGGCCCTCCAGG - Exonic
1049022671 8:139968454-139968476 CCGAGTCCCATTGTTCCTGCTGG - Intronic
1049353513 8:142176722-142176744 CACAGTCCCTGTGGTCTTCCAGG + Intergenic
1050455715 9:5832579-5832601 GCGAGTCCCAGCGGTCCGGCAGG + Intronic
1050546777 9:6716161-6716183 CCGAGTCCCAGCGCGCATCCGGG - Intergenic
1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG + Intronic
1061940814 9:133882894-133882916 CAGAGTCCCTCTTGTCCTCCTGG - Intronic
1062234071 9:135499856-135499878 CCGAGTCCCGCTTCTCCTCCAGG - Exonic
1062446329 9:136596905-136596927 CCAGGTCCCAGTGGGCCCCCAGG + Intergenic
1062519268 9:136950902-136950924 CCGAGGCCCAGGGCACCTCCTGG + Intronic
1062596884 9:137303543-137303565 CTGAGGCCCTGGGGTCCTCCTGG + Intergenic
1203632520 Un_KI270750v1:82013-82035 TCAAGTCCCAGTGGACGTCCAGG + Intergenic
1187754837 X:22511459-22511481 CCAAGTTCAAGTGATCCTCCAGG + Intergenic
1189239425 X:39514326-39514348 CCCAGTCCCAGTGGTCCTCGTGG + Intergenic
1190771576 X:53519125-53519147 TCCAGTCCCAGTGGGACTCCGGG - Intergenic
1192525291 X:71837604-71837626 CTGAGCTCAAGTGGTCCTCCTGG - Intergenic
1196459728 X:115917748-115917770 CCCAGTCCCAGTGGGACTCTGGG + Intergenic