ID: 1089613472

View in Genome Browser
Species Human (GRCh38)
Location 11:119682271-119682293
Sequence CTGGATGGGGGCAAGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089613467_1089613472 -5 Left 1089613467 11:119682253-119682275 CCGGAAAGAAAGAAAGAGCTGGA 0: 1
1: 1
2: 16
3: 150
4: 702
Right 1089613472 11:119682271-119682293 CTGGATGGGGGCAAGAATCCTGG 0: 1
1: 0
2: 0
3: 18
4: 158
1089613465_1089613472 -2 Left 1089613465 11:119682250-119682272 CCACCGGAAAGAAAGAAAGAGCT 0: 1
1: 0
2: 1
3: 29
4: 339
Right 1089613472 11:119682271-119682293 CTGGATGGGGGCAAGAATCCTGG 0: 1
1: 0
2: 0
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089613472 Original CRISPR CTGGATGGGGGCAAGAATCC TGG Intronic
901860324 1:12070174-12070196 CAGGATGGGAGCAGGAAGCCAGG + Intronic
903970985 1:27118585-27118607 CTGCATGGAGGCAAGATCCCAGG + Intronic
908721220 1:67128311-67128333 CAGAGTGGAGGCAAGAATCCAGG + Intronic
909512060 1:76464462-76464484 CTGGATGGAGGTAGGTATCCCGG + Intronic
912971384 1:114286878-114286900 CTGGATGGGGCCAAAAACCTTGG - Intergenic
913694174 1:121308210-121308232 GTGGAGCAGGGCAAGAATCCAGG - Intronic
914143388 1:144971856-144971878 GTGGAGCAGGGCAAGAATCCAGG + Intronic
914877141 1:151520498-151520520 CTGGATGGGAGCAAGGGTCAAGG + Intronic
916133448 1:161631411-161631433 GGAGATGGGGGCAAGCATCCTGG - Intronic
916587529 1:166161528-166161550 CTGGAGGGGGACAAGAATGGTGG + Intronic
916914608 1:169392667-169392689 CTGGATGGGGGGAAGTTGCCAGG + Intronic
920481501 1:206326597-206326619 GTGGAGCAGGGCAAGAATCCAGG - Intronic
921784913 1:219218886-219218908 CTGGATGGGGCCAGGACCCCGGG - Intergenic
922157849 1:223053786-223053808 CTTTATGGGGACAAGAGTCCTGG - Intergenic
922616252 1:226962909-226962931 CTGGGAGGGGACAAGAATTCTGG - Intronic
1063603230 10:7500652-7500674 CTGGATAGGCCCATGAATCCGGG + Intergenic
1064242927 10:13646992-13647014 CTGGATAGAGGGAGGAATCCAGG + Exonic
1065900051 10:30198240-30198262 CTGGGTTGGGGCCAGGATCCAGG - Intergenic
1070834590 10:79440328-79440350 CAGCATGGGGGCATGAGTCCAGG - Intronic
1071501268 10:86205954-86205976 ATGGATGGAGGCAAGGAGCCAGG + Intronic
1072026841 10:91467931-91467953 CTGGTGGGGGGCAGGAATGCTGG - Intronic
1072612085 10:97024301-97024323 CTGCATGGGGGCCGGAGTCCAGG - Intronic
1076686197 10:132199511-132199533 CTGGAGAGGGCCAAGGATCCAGG + Intronic
1077375938 11:2205132-2205154 GTGGCTGGGGGCAGGACTCCTGG + Intergenic
1077591262 11:3492630-3492652 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1080730454 11:34946543-34946565 TTGGATGGTGGCAAGGATCGAGG - Intronic
1084027276 11:66459112-66459134 CTGGATGTTGGCAGGAAGCCTGG - Intronic
1084246963 11:67864381-67864403 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1084825726 11:71730150-71730172 CTGGATGGGGGCATGGAGCTAGG - Intergenic
1085699894 11:78736513-78736535 CTGGATGAGGGCAAGTATCATGG + Intronic
1088810265 11:113387411-113387433 CTGGATAGGGGCAGGGGTCCAGG + Intergenic
1089291649 11:117441038-117441060 CAGGATGGTGGCCAGAATGCAGG + Intronic
1089613472 11:119682271-119682293 CTGGATGGGGGCAAGAATCCTGG + Intronic
1089917927 11:122177110-122177132 CTGGATGGTGGGAAGCATCTAGG + Intergenic
1091387741 12:105331-105353 CAGGGTGGGGGCGGGAATCCTGG + Intronic
1092040312 12:5378392-5378414 TTGACTGGGGCCAAGAATCCTGG - Intergenic
1092099205 12:5869373-5869395 CTCCATGGGGACAAGGATCCAGG + Intronic
1093356741 12:18176316-18176338 TGGGGTGGGGGCAAGACTCCTGG - Intronic
1093380235 12:18482584-18482606 CTGCAGGGGTGCAAGAATGCAGG + Intronic
1096195712 12:49647637-49647659 CTGGCTGGGGGAGAGAAGCCTGG - Intronic
1097284945 12:57870031-57870053 CTGCAGCGGGGCAAGAATTCAGG - Intergenic
1097694565 12:62763995-62764017 CTGGATCGAGGCAGGAATCCAGG - Intronic
1102709541 12:114914085-114914107 CTGGATGGGGGCCAGAGTCAGGG + Intergenic
1104917563 12:132273816-132273838 CTGGATGGGGCCGACATTCCTGG - Intronic
1106775009 13:33000221-33000243 CTGGAGTGGGGCAAGAATGAAGG + Intergenic
1114568833 14:23651533-23651555 CAGGATGAGGGCAAGAGTCAGGG + Intergenic
1114613589 14:24056977-24056999 CTGGACCTGAGCAAGAATCCTGG + Exonic
1116059092 14:39898367-39898389 CAGGATGGGTCCAAGAATCAAGG + Intergenic
1117974648 14:61285347-61285369 TTGGATAGGGGAAAGAATGCTGG + Intronic
1118606445 14:67507425-67507447 AGGGATAGGGGGAAGAATCCTGG + Intronic
1119609266 14:76047879-76047901 GTGGGTGGGGGCCAGAATCAAGG + Intronic
1128729795 15:70013583-70013605 CAGCATGGGGGCTAGAACCCAGG + Intergenic
1129043735 15:72714129-72714151 CAGGATGAGGGGAAGAAGCCTGG + Intronic
1131183313 15:90255235-90255257 CTGGATGGGTGGCAGCATCCGGG - Intronic
1131418071 15:92278063-92278085 ATGGCTGGGGTCAAGAAGCCTGG + Intergenic
1132267501 15:100487650-100487672 CTGAATGGGGCCAAGAGACCTGG + Intronic
1136413782 16:30091593-30091615 CTGGACGGAGCCAAGAGTCCCGG + Intronic
1137840864 16:51639773-51639795 CTGGATGTATGAAAGAATCCTGG - Intergenic
1137950861 16:52782108-52782130 ATGGATGAGGGCCAGAAACCAGG + Intergenic
1139527991 16:67528454-67528476 CTGGTTGGTGGAAAGGATCCAGG - Intronic
1140228204 16:73095834-73095856 GTGGAGGGGGAAAAGAATCCCGG + Intergenic
1140923916 16:79565008-79565030 CTGGGAGAGGGCAAGAGTCCGGG + Intergenic
1142341864 16:89528574-89528596 CAGGATGAGGGCAAAAGTCCTGG + Intronic
1145097330 17:20042171-20042193 CTAGATGGGGGTAAATATCCAGG + Intronic
1145213802 17:21036833-21036855 CTTGAGGGGGCCAAGAAGCCAGG + Intronic
1151640498 17:75389025-75389047 CTGGATGGTGGCAAGTAATCGGG - Intronic
1160988582 19:1851540-1851562 CTGGAGGGGTGCGAGAGTCCCGG + Intergenic
1161250087 19:3275781-3275803 CTGGAGGGAGGGAGGAATCCCGG + Intronic
1161307330 19:3575325-3575347 CTGGAGGTGGGGAAGAGTCCGGG + Intronic
1161330221 19:3683355-3683377 TTGGATGGGGTCAAGAGCCCAGG + Intronic
1166599587 19:44082211-44082233 CAGGAAGGAGGTAAGAATCCAGG - Intronic
1167041779 19:47027108-47027130 CTGCATGGGGGCAAGCACCATGG - Intronic
1167460844 19:49624068-49624090 TAGGATGGGGCCAAGAATTCTGG + Intronic
1167480632 19:49728629-49728651 CTGGATGGGGGAGAAAATTCGGG + Intergenic
1167917627 19:52755029-52755051 CTTCATGGGGGCTCGAATCCAGG - Intergenic
925306033 2:2848897-2848919 CTGGGTGGGGGAAGGAAGCCAGG + Intergenic
926094844 2:10074424-10074446 CTGCATGGGGGCAGGAGCCCAGG - Intronic
926785976 2:16518841-16518863 CAGGGTGGGGGCAAAAATCTTGG + Intergenic
927039446 2:19213428-19213450 CTGGAATGGGGCAAGCAGCCAGG + Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
928578472 2:32680636-32680658 CTGGATGGGGACAAGTGTCTAGG + Intronic
929505731 2:42526371-42526393 CTGGGTGAGGCCAAGATTCCTGG + Intronic
931359718 2:61567827-61567849 CAGGATAGTGGCATGAATCCGGG + Intergenic
932115048 2:69038422-69038444 CTGTATGAGGAGAAGAATCCAGG + Intronic
932708725 2:74047051-74047073 CAGGAAGGGGGCAAGAAGCCTGG - Exonic
949036676 2:241818675-241818697 CAGGATGGGGGCCTGGATCCGGG + Intergenic
1168759684 20:341390-341412 GTGGGTGGGGGCAAGAATCTGGG - Intergenic
1173255690 20:41393097-41393119 CTGGCTGGGGGCACAAAGCCCGG - Intergenic
1173735214 20:45356407-45356429 ATGGATGGGGTCAAGAATCAAGG + Intergenic
1174267635 20:49343524-49343546 CTGGTCTGGGGCGAGAATCCTGG + Intergenic
1176057069 20:63154625-63154647 AAGGACGGGGGCAAGAATCTGGG - Intergenic
1179471121 21:41611211-41611233 CAGGATGGGGGCAGTAAGCCAGG + Intergenic
1180164536 21:46017146-46017168 CTGGATGGTGGCAGGATTTCTGG + Intergenic
1181476224 22:23169243-23169265 CTGGCTGGGGGCAGGAATAAAGG + Intergenic
1181928062 22:26376334-26376356 CTGGGAGGGGGCAAGAATTCTGG + Intronic
1182361373 22:29748385-29748407 CTGGCTGGGGGCCAGGCTCCTGG - Intronic
1183915778 22:41117597-41117619 ATGAATGCGGGCATGAATCCTGG + Exonic
1185360743 22:50405252-50405274 CTGGAGGGAGGCAAGAGGCCTGG + Intronic
950195564 3:11006913-11006935 CTTGTTGGGGGCTAGAATCTGGG - Intronic
950710468 3:14810178-14810200 CTCCATGAGGGCAAGAATCTGGG + Intergenic
950880567 3:16319642-16319664 CTGGATGTGGCCAGGCATCCAGG - Intronic
952491991 3:33882007-33882029 GTGCTTGGGGGCAGGAATCCAGG + Intergenic
954625536 3:52020123-52020145 CCGGATGGGGGCAAGGAGCCAGG - Intergenic
954701245 3:52452045-52452067 CTGGCTGGGGGCTGGAATGCTGG - Intronic
954916561 3:54152950-54152972 CATGATGTGGGCAGGAATCCAGG + Intronic
957061283 3:75483132-75483154 CTGGATGGGGGCACGGAGCTAGG + Intergenic
961112262 3:124294868-124294890 CAGAATGGAGGCAAGCATCCTGG - Intronic
961895080 3:130160115-130160137 CTGGATGGGGGCATGGAGCTAGG + Intergenic
962806459 3:138930843-138930865 CTGGCTGGGTGCAAGAATGAGGG - Intergenic
964669363 3:159208527-159208549 CTGGATGAGGACAAGTACCCTGG - Intronic
967270609 3:187729315-187729337 CTGGAGGGGAGCCAGAAGCCTGG + Exonic
969005178 4:4013172-4013194 CTGGATGGGGGCATGGAGCTAGG + Intergenic
969428282 4:7138495-7138517 CTGGATGGGGGCAAGGACTCCGG + Intergenic
969870872 4:10103870-10103892 CTGTATGGGGGCAAGGCTCGTGG - Intronic
969897294 4:10317320-10317342 CTGGATCGGTGCTAGATTCCTGG - Intergenic
975717124 4:77215954-77215976 CTGGCAGGGGTCAACAATCCTGG - Intronic
976828918 4:89290971-89290993 ATGGATGGAGGCAAGTATCATGG - Intronic
978313263 4:107409454-107409476 CTGGAAGGGGGGATGAAGCCAGG + Intergenic
982610997 4:157574627-157574649 CTGGATGGGGGCAAGCAGCAAGG - Intergenic
986292353 5:6410377-6410399 CTGGATGGGAGCGAGAGACCTGG - Intergenic
986527408 5:8695057-8695079 CAGGATGGGGTAAAGAATGCTGG - Intergenic
989568033 5:42920468-42920490 CTGTATGGGGGCAAGTACACAGG + Intergenic
989574333 5:42975495-42975517 CTATATGGGGGCAAGTATACAGG + Intergenic
989613530 5:43317423-43317445 GTCGGTGGGGGCAAGACTCCTGG + Intergenic
992657008 5:78920663-78920685 CTCTATGGGGACAAGAGTCCAGG - Intronic
994354373 5:98778351-98778373 CTGGATGGGGGAAAAAATTCAGG - Intronic
995004555 5:107175628-107175650 CTGGATGCTGGCAAGAATTCAGG - Intergenic
997714636 5:136033028-136033050 CTAGATGGGGCCTAGCATCCAGG - Intronic
999188223 5:149728637-149728659 CTGGATGAAGGCAAGAAGGCGGG - Intergenic
999625671 5:153517786-153517808 CTGGAAGGAGGCAAGAAGACAGG - Intronic
999760861 5:154699954-154699976 CTGGATGGGAATAAGAGTCCTGG - Intergenic
1001228314 5:169964275-169964297 CCTGATGGGGGCCAGAGTCCGGG - Intronic
1001388567 5:171359954-171359976 CTGGGTGGGGACGCGAATCCAGG - Intergenic
1002339670 5:178506549-178506571 CTGGATGGGAGCAAGAGGCCTGG + Intronic
1003196628 6:3920538-3920560 CAGGATGGGGGCAGGTCTCCAGG + Intergenic
1006170471 6:32089111-32089133 CTGGATGGGGGCTAGGCTCTTGG - Intronic
1010373007 6:75133654-75133676 CTGGCCAGGGGGAAGAATCCTGG + Intronic
1013577199 6:111495680-111495702 CAGGATGAGGGCAGGAATTCAGG - Intergenic
1017282380 6:152638316-152638338 CTGCCTGAGGGCAACAATCCTGG + Intergenic
1019902093 7:4028905-4028927 CTTGATGGGGACAGGACTCCAGG + Intronic
1020376148 7:7489783-7489805 CTGGATGGTGGCAAGAGGGCAGG - Intronic
1023982435 7:45077906-45077928 CTGGTAGGGGGCAAGAGCCCAGG - Intergenic
1024895689 7:54259343-54259365 CTGGAAGGAGGCAAGCATCCAGG - Intergenic
1024966200 7:55023989-55024011 TTGAATTTGGGCAAGAATCCAGG + Intronic
1030177052 7:106665283-106665305 CTGAATGGGGGTAGGAATTCTGG - Intergenic
1030282054 7:107786827-107786849 GTGGTTGGGGACATGAATCCTGG - Exonic
1030744973 7:113153972-113153994 TTGGAAGGAGGCAAGGATCCTGG + Intergenic
1031823683 7:126535392-126535414 CTGGGTGGAGCCAAGAATTCTGG - Intronic
1032067425 7:128782243-128782265 CTGGAAGTGAGCAAGAATCCAGG + Intergenic
1032153072 7:129446690-129446712 CAGGCTGGGGGAAAGAAGCCAGG + Intronic
1034584531 7:152077456-152077478 CTTGCTGTGGGTAAGAATCCTGG + Intronic
1035707155 8:1685144-1685166 CTGGATGGGGAGAAGCACCCCGG + Intronic
1036370756 8:8161153-8161175 CTGGATGGGGGCATGGAGCTAGG - Intergenic
1036746317 8:11412637-11412659 CTGGATGGGAGCCAGGATCCAGG + Intronic
1036880137 8:12504477-12504499 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1037698356 8:21248268-21248290 CGGGATGGTGACAAGAGTCCTGG + Intergenic
1037810192 8:22082193-22082215 TTGGATGGGGTCAAGAGGCCAGG + Exonic
1046592673 8:116224921-116224943 TTTGCTGGTGGCAAGAATCCTGG - Intergenic
1048250440 8:132862601-132862623 CTGGATGGGAGCAGAAGTCCAGG + Intergenic
1048714787 8:137256297-137256319 GTGGATGGGGGCAACAATTCAGG + Intergenic
1052366221 9:27614910-27614932 CTGGATAAGGGGCAGAATCCAGG - Intergenic
1055401053 9:75924586-75924608 GGGGGCGGGGGCAAGAATCCTGG - Intronic
1057523022 9:95775175-95775197 CTTGATGGCGGCAAGGAGCCAGG + Intergenic
1058281105 9:103115669-103115691 CTGGATGAGGGTAGAAATCCAGG - Intergenic
1060553339 9:124495901-124495923 CCGGATGGGGGCTCGAATGCAGG - Intronic
1061493037 9:130956809-130956831 CTCGTTGGGGGAAGGAATCCGGG - Intergenic
1062091868 9:134682577-134682599 CAGGAAGGGCGCAGGAATCCCGG + Intronic
1062214970 9:135384246-135384268 CTGGACGGGGGGAAGCCTCCTGG - Intergenic
1062291497 9:135797288-135797310 CTGGATGGGAGCTGGCATCCTGG - Intergenic
1062706836 9:137950296-137950318 CTGGATGGTGGTAAAAGTCCTGG + Intronic
1186869402 X:13755443-13755465 CAGGATGTGGGCAGGACTCCAGG - Intronic
1190866191 X:54386744-54386766 CTTGAAGGCAGCAAGAATCCGGG - Intergenic
1192794866 X:74418797-74418819 CTAGATGGATGCAAGATTCCAGG + Intergenic
1194665926 X:96677683-96677705 AGGGCTGGGGGCAAGAAGCCAGG - Intergenic
1195198839 X:102526711-102526733 CTGGATATTGGCAAGAATGCAGG - Intergenic
1195290549 X:103428704-103428726 CAGCCTGGGGTCAAGAATCCTGG - Intergenic
1200967425 Y:9109959-9109981 CTGGATGGGGGAAAGAAGACTGG + Intergenic