ID: 1089614129

View in Genome Browser
Species Human (GRCh38)
Location 11:119685631-119685653
Sequence CATCCACATGGCCCATCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089614120_1089614129 6 Left 1089614120 11:119685602-119685624 CCTGCAGGCCTGTTTCATGCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 1089614129 11:119685631-119685653 CATCCACATGGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 12
4: 143
1089614122_1089614129 -2 Left 1089614122 11:119685610-119685632 CCTGTTTCATGCTGGCTGCCCCA 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1089614129 11:119685631-119685653 CATCCACATGGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 12
4: 143
1089614119_1089614129 18 Left 1089614119 11:119685590-119685612 CCTGGATTCTGTCCTGCAGGCCT 0: 1
1: 0
2: 5
3: 21
4: 249
Right 1089614129 11:119685631-119685653 CATCCACATGGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089614129 Original CRISPR CATCCACATGGCCCATCATG GGG Intronic
902657227 1:17877584-17877606 GATCCACGAGGCCCTTCATGTGG + Intergenic
903860910 1:26364000-26364022 CATCCGCATCGCCCAGCAGGGGG - Intronic
906102640 1:43273010-43273032 CATCCGCCAGGCCCACCATGTGG + Exonic
908928584 1:69288156-69288178 TATCCACATGGACCTTCAAGAGG - Intergenic
910292001 1:85608277-85608299 CATACACATAGCCAAGCATGGGG + Intergenic
912945306 1:114079595-114079617 CATCCAGGTGCCCCATCATGGGG - Intergenic
915191406 1:154154017-154154039 CAACCACATAACCCATCATTGGG + Intronic
915466108 1:156099002-156099024 CTTCCTAATTGCCCATCATGAGG - Intronic
917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG + Intergenic
1062886503 10:1020649-1020671 CATCCTCATGGTGCTTCATGAGG + Intronic
1064974987 10:21104642-21104664 TATCCACATAGACAATCATGTGG + Intronic
1067005935 10:42662485-42662507 CAACCACATGGATCATCTTGAGG - Intergenic
1068937488 10:62650088-62650110 CTTGCAGACGGCCCATCATGGGG + Intronic
1070390119 10:75962574-75962596 CATGCACATGGCCTGCCATGAGG + Intronic
1075915983 10:126167785-126167807 CATCCACATGGTCTATGATGTGG + Intronic
1076188749 10:128468368-128468390 CAACCACATGCCCCAGAATGGGG + Intergenic
1077283010 11:1754047-1754069 CATCCACCGGGCCCACCATGAGG + Exonic
1079454108 11:20622467-20622489 CATACACATTTCTCATCATGTGG + Intronic
1080701743 11:34650033-34650055 CATCCAGATGGCCCATCCCCTGG - Intronic
1080960581 11:37154099-37154121 CCTCCACAAGGCCCCTCAAGGGG - Intergenic
1082884159 11:58066355-58066377 AATCCACATGTCCTATCCTGCGG - Intronic
1084697174 11:70762672-70762694 CATCCAGATGGCTCATACTGAGG - Intronic
1085320140 11:75569021-75569043 CATCCTCATGCCCCATCACGTGG + Exonic
1085781404 11:79412301-79412323 CACCCAGCTGGGCCATCATGAGG - Intronic
1086373109 11:86174512-86174534 CAGCCACATGGCCCATAGGGAGG + Intergenic
1089614129 11:119685631-119685653 CATCCACATGGCCCATCATGGGG + Intronic
1091928971 12:4379396-4379418 CATCCACATGGCCATTCTTGTGG + Exonic
1094726057 12:33117489-33117511 CAGCAACATGGACCATGATGGGG + Intergenic
1096546103 12:52341295-52341317 CAGTGCCATGGCCCATCATGGGG + Intergenic
1101109838 12:101474719-101474741 CAACCACATGGCCCCCCATAAGG + Intergenic
1102603520 12:114051444-114051466 CATCCACCTGGCCCACCTGGAGG + Intergenic
1102782098 12:115574103-115574125 CATCCAAATGGCCCATTCGGAGG - Intergenic
1102895687 12:116596381-116596403 CATACAAATGGCCAATAATGTGG + Intergenic
1103157594 12:118699769-118699791 CACACACATAGCCCATCATTTGG + Intergenic
1106202605 13:27553219-27553241 AAGCCACATGACCCATGATGGGG + Exonic
1107869642 13:44734998-44735020 CCTCCACATGGACCATCTTCTGG - Intergenic
1108950128 13:56082058-56082080 AAGCCACAAGTCCCATCATGAGG - Intergenic
1116245501 14:42406619-42406641 CTTGCAGATGGCCTATCATGGGG - Intergenic
1117435848 14:55714599-55714621 GATCCAGATGGCACATCTTGTGG - Intergenic
1119788015 14:77327175-77327197 CATCCAGAGGGCCCAGTATGGGG - Intronic
1120470121 14:84912494-84912516 CATTCACATGGTTCATCAGGTGG + Intergenic
1124183790 15:27502933-27502955 CTTCCAGATGGCCGAACATGTGG - Intronic
1128633790 15:69289888-69289910 AATCCACATGGCTCATCAGATGG + Intergenic
1130561665 15:84963782-84963804 CATCCTCATGAGCCATGATGAGG - Intergenic
1131731778 15:95289172-95289194 CAGCCACATGACCAATAATGTGG + Intergenic
1132415407 15:101615481-101615503 CCTCAGCACGGCCCATCATGAGG + Intergenic
1136573705 16:31111130-31111152 CAGCCACATGGCCATTGATGCGG - Exonic
1142248220 16:88979402-88979424 CATCAACATGGCCCAGCATGTGG + Intergenic
1144702629 17:17348988-17349010 CATTCTCCTGGCCCTTCATGAGG - Intergenic
1144749137 17:17636062-17636084 AAGCCACAAGTCCCATCATGGGG - Intergenic
1145900789 17:28489312-28489334 CATCCACGATGCCCATCATAGGG - Exonic
1146550608 17:33777364-33777386 CTTCATCATGACCCATCATGAGG - Intronic
1148972944 17:51500154-51500176 CCTACAGATGGCCCATCAGGAGG - Intergenic
1151564891 17:74892576-74892598 CAGCCACCTGGCCACTCATGGGG - Exonic
1151863992 17:76787723-76787745 CATCCTCTTGGCCCATTAAGGGG - Intergenic
1154468939 18:14679152-14679174 CAACCACATGGATCATCTTGAGG + Intergenic
1155108873 18:22694341-22694363 CATCCACATGGGCGATAACGTGG - Intergenic
1157330241 18:46698770-46698792 CAGCCACATGACCCAGCAAGAGG + Intronic
1157723111 18:49941098-49941120 CACCTACATGGACAATCATGCGG + Intronic
1160520109 18:79503059-79503081 CAACCACAATGCCCAGCATGTGG + Intronic
1161614783 19:5264008-5264030 CACCCACATGGCCCATCTGTGGG - Intronic
1162050215 19:8028425-8028447 CATCCCCAGTGCCCAGCATGGGG + Intronic
1162131271 19:8527472-8527494 CATCCCCACAGCCCATCAAGCGG - Exonic
1162187171 19:8914711-8914733 AATCTGCATGGCCCATCATCAGG - Intronic
1162480605 19:10924842-10924864 CATCCACAGTCCCCACCATGTGG + Intronic
1162552528 19:11365531-11365553 CATACAGATGTGCCATCATGGGG + Exonic
1163423838 19:17229982-17230004 TACCCACATGGCCCTTCCTGCGG - Intergenic
1164591346 19:29509133-29509155 CACCCACATAGCCCAACATGAGG - Intergenic
1166671344 19:44711193-44711215 CATCCACAGGGCCTTTCCTGTGG - Intergenic
925594612 2:5543094-5543116 AAACCACATCACCCATCATGGGG - Intergenic
929080189 2:38114670-38114692 CATCCACAAGACCCACCAGGAGG - Intergenic
931443845 2:62310115-62310137 CACCCCCATGGCCCCTAATGAGG - Intergenic
934518608 2:95005430-95005452 TATTCACATTGACCATCATGGGG - Intergenic
936044869 2:109179681-109179703 AAGCCACAAGTCCCATCATGGGG + Intronic
936548618 2:113414779-113414801 CTTCCAGATGCCCTATCATGTGG + Intergenic
938293649 2:130163390-130163412 CCTCCACATGGCAAAGCATGGGG + Intronic
938462902 2:131509569-131509591 CCTCCACATGGCAAAGCATGGGG - Intergenic
940135184 2:150427436-150427458 CATCAAAATGGCCCTTTATGGGG - Intergenic
940363586 2:152821305-152821327 CAGCCATATGGCCCATAATGAGG - Intergenic
948085687 2:235245015-235245037 CAGCCACGAGGGCCATCATGTGG - Intergenic
1173385855 20:42587319-42587341 CAGACACATTGCCCAGCATGGGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174765237 20:53247408-53247430 CCTCCACATGGCCCTCCAAGAGG + Intronic
1174919692 20:54688457-54688479 CATCTACATGGCCCATAAGCTGG + Intergenic
1176805581 21:13478519-13478541 CAACCACATGGATCATCTTGAGG - Intergenic
1180115919 21:45704954-45704976 CCTCCACAGAGCCCATCTTGGGG + Intronic
1180352098 22:11814145-11814167 CATCCACGTGGGCCAGCAGGAGG + Intergenic
1180353386 22:11821409-11821431 CATCCACGTGGGCCAGCAGGAGG - Intergenic
1180384853 22:12170948-12170970 CATCCACGTGGGCCAGCAGGAGG + Intergenic
1180386110 22:12177921-12177943 CATCCACGTGGGCCAGCAGGAGG - Intergenic
1181633278 22:24162464-24162486 CATTCACATGCCCCAGTATGGGG - Intronic
950765734 3:15271807-15271829 CCATCACATGGCCCATCTTGGGG - Intronic
952506466 3:34010906-34010928 CCTCCACATGGCATATCATCTGG - Intergenic
955197961 3:56822892-56822914 TAACCACATGGCCCATCATTGGG - Intronic
955810157 3:62779507-62779529 AATCTTCTTGGCCCATCATGTGG + Intronic
955906236 3:63810604-63810626 CATTGACATGGCCCAACCTGTGG - Intergenic
958174537 3:89979309-89979331 CATCCACAAAGCACATCATTAGG - Intergenic
961860465 3:129913118-129913140 CAGCCACATCCCCCATTATGGGG - Intergenic
966569099 3:181420837-181420859 CAGCCACATGGTCTCTCATGGGG + Intergenic
971082538 4:23231010-23231032 CACCAACATTGCCCATTATGTGG + Intergenic
971869325 4:32215748-32215770 CCTTCTCATGGCCCATAATGTGG + Intergenic
973694489 4:53476764-53476786 CAGCCACATGACCCAGGATGGGG + Exonic
975086849 4:70352062-70352084 CACCCACATTGTCCATCATCTGG + Intergenic
978637089 4:110822470-110822492 TCTCCAAATGGCCCATCATGTGG - Intergenic
985337287 4:188910405-188910427 CCACCACAGGGCCCATCTTGTGG + Intergenic
985766037 5:1780012-1780034 CATGCACTTGCCCCATCCTGAGG + Intergenic
986777592 5:11031973-11031995 CTTGCAGATGGCCTATCATGGGG + Intronic
994439603 5:99785391-99785413 CTTCCACATGGCTGAACATGTGG - Intergenic
999621463 5:153479067-153479089 CATCCTCCTGTCCCATCATTGGG + Intergenic
999681753 5:154066872-154066894 CATCCACAATGTCCATCAAGAGG - Intronic
1001557279 5:172645377-172645399 CATCCACATGGCCCCTTATCTGG - Intronic
1003233609 6:4276310-4276332 CATGAACAGGGTCCATCATGGGG - Intergenic
1006579650 6:35069333-35069355 CATCCACAGGCCTCAGCATGTGG + Intronic
1007797430 6:44361410-44361432 CATCCACATGGCACCTCAAGTGG - Intronic
1012961825 6:105630326-105630348 CATCCAAACAGCCCATCAAGTGG - Intergenic
1014746647 6:125208662-125208684 CCTCCACATGTCCTAGCATGAGG - Intronic
1015264336 6:131275680-131275702 CCTCCACATGGCTCCTCATATGG - Intronic
1017463428 6:154672568-154672590 CATCCACATATCCCACCAAGGGG - Intergenic
1022791793 7:33696390-33696412 AATGCATATGGCCCAACATGGGG + Intergenic
1023921396 7:44632850-44632872 CATCCACCAGGCGGATCATGAGG - Intronic
1024095606 7:45980211-45980233 CATCCCCAAGGCCCCTCGTGAGG + Intergenic
1027686164 7:81280765-81280787 CTTGCACATGGCCTATCTTGGGG + Intergenic
1028963566 7:96776624-96776646 CATCCACATTATCCAGCATGTGG - Intergenic
1029199166 7:98827208-98827230 CATCAGAATGGCCCATCAGGGGG + Intergenic
1030350007 7:108474068-108474090 CATGCATCTGACCCATCATGAGG - Intronic
1033487905 7:141809688-141809710 CTTGCAGATGGCCTATCATGGGG - Intergenic
1034545157 7:151784610-151784632 CATTCACTTGGGCCACCATGAGG + Intronic
1034807001 7:154097844-154097866 AATCCAAATGCCACATCATGAGG - Intronic
1035293440 7:157854382-157854404 CGTCCACGTGGCTCCTCATGGGG + Intronic
1038515523 8:28184375-28184397 CCTCCAAAAGGCCCATCGTGAGG + Intronic
1038780945 8:30568196-30568218 AATAAACATGGGCCATCATGTGG - Intronic
1049323436 8:142009660-142009682 CATCCAAATGACTCAACATGTGG + Intergenic
1049904379 9:202393-202415 CTTCCAGATGCCCTATCATGTGG - Intergenic
1050889183 9:10802627-10802649 CTTCCCCATGGCTCAACATGGGG - Intergenic
1052963314 9:34319207-34319229 CATCCTCATGCCCCACCACGTGG + Intronic
1053726950 9:41013967-41013989 CTTCCAGATGCCCTATCATGTGG - Intergenic
1061849886 9:133408119-133408141 CATCCCCATCTCCCATCTTGAGG + Intronic
1062233704 9:135497999-135498021 CATTCACCTGGACCTTCATGGGG + Intronic
1062607364 9:137354190-137354212 CAGCCACACGCCCCAACATGGGG + Intronic
1185649335 X:1637285-1637307 CATCCTCATGAACCATCAGGAGG - Intronic
1185649394 X:1637610-1637632 CATCCTCATGAACCATCAGGAGG - Intronic
1185649423 X:1637775-1637797 CATCCTCATGAACCATCAGGAGG - Intronic
1185649467 X:1638023-1638045 CATCCTCATGAACCATCAGGAGG - Intronic
1185649511 X:1638271-1638293 CATCCTCATGAACCATCAGGAGG - Intronic
1185649540 X:1638436-1638458 CATCCTCATGAACCATCAGGAGG - Intronic
1185649599 X:1638764-1638786 CATCCTCATGAACCATCAGGAGG - Intronic
1185649657 X:1639094-1639116 CATCCTCATGAACCATCAGGAGG - Intronic
1185649743 X:1639587-1639609 CATCCTCATGAACCATCAGGAGG - Intronic
1185649801 X:1639917-1639939 CATCCTCATGAACCATCAGGAGG - Intronic
1185649861 X:1640247-1640269 CATCCTCATGAACCATCAGGAGG - Intronic
1185649891 X:1640412-1640434 CATCCTCATGAACCATCAGGAGG - Intronic
1185649949 X:1640740-1640762 CATCCTCATGAACCATCAGGAGG - Intronic
1185650009 X:1641070-1641092 CATCCTCATGAACCATCAGGAGG - Intronic
1185650039 X:1641235-1641257 CATCCTCATGAACCATCAGGAGG - Intronic
1186182363 X:6985703-6985725 CTTCCACACGGCCCATCTGGAGG + Intergenic
1195211401 X:102654588-102654610 CATGCACATGGCCAATCAAGAGG + Exonic
1200285918 X:154822209-154822231 CTGCCACATGGCCTGTCATGTGG - Intergenic