ID: 1089614485

View in Genome Browser
Species Human (GRCh38)
Location 11:119687510-119687532
Sequence ACAGTGTTGTTTGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089614485_1089614487 1 Left 1089614485 11:119687510-119687532 CCAGCTGCAGCAAACAACACTGT 0: 1
1: 0
2: 2
3: 11
4: 217
Right 1089614487 11:119687534-119687556 TTGTAGCAGACACGGCAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 79
1089614485_1089614486 -7 Left 1089614485 11:119687510-119687532 CCAGCTGCAGCAAACAACACTGT 0: 1
1: 0
2: 2
3: 11
4: 217
Right 1089614486 11:119687526-119687548 ACACTGTCTTGTAGCAGACACGG 0: 1
1: 0
2: 0
3: 11
4: 126
1089614485_1089614488 12 Left 1089614485 11:119687510-119687532 CCAGCTGCAGCAAACAACACTGT 0: 1
1: 0
2: 2
3: 11
4: 217
Right 1089614488 11:119687545-119687567 ACGGCAGCCTGGATTTCCCTCGG 0: 1
1: 0
2: 11
3: 117
4: 771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089614485 Original CRISPR ACAGTGTTGTTTGCTGCAGC TGG (reversed) Intronic
900677329 1:3896072-3896094 CCTGTGTTCTTGGCTGCAGCAGG - Intronic
905354363 1:37370864-37370886 ACAGTCTTCATTTCTGCAGCTGG - Intergenic
906242302 1:44249480-44249502 GGAGTGTTGGTTCCTGCAGCTGG - Intronic
909858783 1:80576084-80576106 TCAGTGTTGGTTTCTGCTGCTGG + Intergenic
910830964 1:91462459-91462481 TCAGTGTTGGTCGCTGCTGCTGG + Intergenic
911980550 1:104560385-104560407 TCAGTGTTGGTCGCTGCTGCTGG - Intergenic
913559294 1:120001544-120001566 GCAGTGTTGGTTTCTGCTGCTGG - Intronic
913638568 1:120788998-120789020 GCAGTGTTGGTTTCTGCTGCTGG + Intergenic
914279890 1:146160987-146161009 GCAGTGTTGGTTTCTGCTGCTGG - Intronic
914540928 1:148611905-148611927 GCAGTGTTGGTTTCTGCTGCTGG - Intronic
914625712 1:149459341-149459363 GCAGTGTTGGTTTCTGCTGCTGG + Intergenic
915489703 1:156244241-156244263 ACACTGGTCTTGGCTGCAGCTGG - Exonic
915775812 1:158484957-158484979 ACAGTGTTCTTTGCTACTGTAGG - Intergenic
916561446 1:165937041-165937063 ACAGTTTTGGTTGCTACAACTGG - Intergenic
918051568 1:180977383-180977405 ACAGGATTGTGAGCTGCAGCAGG - Intronic
918313843 1:183306191-183306213 ACTGTGTTGGTTGGTGCTGCAGG + Intronic
918706225 1:187665705-187665727 ACAGTTTTGACTGCCGCAGCTGG - Intergenic
918918103 1:190670923-190670945 TCAGTGTTGGTAGCTGCTGCTGG + Intergenic
919789570 1:201282412-201282434 TCAGTGTTGTTTGCTTTAGGAGG + Intergenic
922819677 1:228475586-228475608 CCATTGTTTTCTGCTGCAGCAGG - Intergenic
922914017 1:229240880-229240902 ACAGTATTGTTAGCTGAGGCCGG - Intergenic
1068059612 10:52050945-52050967 ATAGTTTTGATTTCTGCAGCTGG + Intronic
1074393172 10:113074813-113074835 ACAGTGTTGGTTGTAACAGCTGG + Intronic
1074856864 10:117480293-117480315 ACACTGTGGTTGGATGCAGCTGG - Intergenic
1075074090 10:119339024-119339046 ACAGTGCTGTTTGCTTCCTCTGG + Intronic
1075408021 10:122207478-122207500 ACAGTGTTGGTTGTCACAGCTGG + Intronic
1076165392 10:128278385-128278407 ACAGTGTTGCCTGCTGCAGGGGG + Intergenic
1080076879 11:28159552-28159574 ACAGTCTTCATTTCTGCAGCTGG - Intronic
1081366310 11:42239506-42239528 AAAGTGTTATTTAATGCAGCTGG - Intergenic
1081612310 11:44569990-44570012 CCATTGTTGTTTGCTGTATCTGG + Intronic
1083449849 11:62736243-62736265 ACAGTGTTGTTTTTTGGGGCTGG + Intronic
1084246290 11:67859596-67859618 ACAATTTTGGTTGTTGCAGCTGG + Intergenic
1084569309 11:69949906-69949928 AGAGAGCTGTTTGCTTCAGCAGG + Intergenic
1084826392 11:71734904-71734926 ACAATTTTGGTTGTTGCAGCTGG - Intergenic
1085300993 11:75458114-75458136 ACCGTGTTGCTTTGTGCAGCGGG - Intronic
1085447380 11:76609907-76609929 TCCGTGTTGTTTACTTCAGCAGG - Intergenic
1085748464 11:79136510-79136532 TCAGTGTTGTTCTCTGCTGCTGG - Intronic
1088265554 11:107984538-107984560 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1088923554 11:114279458-114279480 GCAGTGTTGTTTCCTCTAGCAGG - Intronic
1089614485 11:119687510-119687532 ACAGTGTTGTTTGCTGCAGCTGG - Intronic
1092381958 12:8003740-8003762 ACAGTCTTCGTTTCTGCAGCTGG - Intergenic
1095738631 12:45585063-45585085 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1095851193 12:46808813-46808835 GCAGTGCTGTTTTCTGAAGCAGG - Intronic
1097873201 12:64619097-64619119 ACAATGCTGTTTGCTGAAGCAGG + Intronic
1099700754 12:86078612-86078634 TCAGTGTTGGTCGCTGCTGCTGG + Intronic
1101697239 12:107138298-107138320 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
1103142449 12:118560632-118560654 AAAGTGTTCATTTCTGCAGCGGG - Intergenic
1105617450 13:22031900-22031922 ACAGGCTAGCTTGCTGCAGCAGG + Intergenic
1107277512 13:38692843-38692865 TCTGTGTTGTATGCTGCAGGTGG + Intronic
1111496828 13:89061891-89061913 ACAGCTGTGTTTGTTGCAGCTGG - Intergenic
1112589752 13:100752041-100752063 ACAGTCTCGTCTGCTGCTGCAGG - Intergenic
1112981770 13:105393703-105393725 ACAGTGTTGGTCTCTACAGCTGG + Intergenic
1113350512 13:109524842-109524864 TCAGTGATGTTTGATGGAGCAGG + Intergenic
1113771655 13:112913449-112913471 AAAGTTATGTTTGATGCAGCTGG + Intronic
1114702067 14:24688800-24688822 ACAGTGTAGTTTTATGCAGAAGG + Intergenic
1115166151 14:30450868-30450890 ACAGTTTTGCTTGCTCAAGCCGG - Intergenic
1115304207 14:31917171-31917193 AAAGTGTAGATTGGTGCAGCTGG - Intergenic
1116283358 14:42939438-42939460 ACAACTTTGATTGCTGCAGCTGG + Intergenic
1116845730 14:49863179-49863201 TCAGCGTTGCTTGCTTCAGCAGG + Intergenic
1117690816 14:58303363-58303385 ACAGTGTTCTATACCGCAGCAGG - Intronic
1119059572 14:71461258-71461280 TCAGTGTTGGTCTCTGCAGCTGG + Intronic
1123994379 15:25708114-25708136 ACATTGTTGAGTGCTGCACCGGG + Intronic
1124037242 15:26065939-26065961 TCAGTGTGGTTGGCTGCAGGGGG - Intergenic
1124091722 15:26610431-26610453 AATGTGTTGGTTGTTGCAGCAGG + Intronic
1126453257 15:48833575-48833597 ACAGGATAGCTTGCTGCAGCTGG - Intronic
1126798331 15:52278489-52278511 ACAGGGTTTTTAGCTGCAGGAGG - Intronic
1127734976 15:61831534-61831556 CCAGTGTTAGTGGCTGCAGCTGG - Intergenic
1129906061 15:79187982-79188004 GCAGTGTTGTTAGCTGAGGCTGG - Intergenic
1132135756 15:99337066-99337088 TGACTTTTGTTTGCTGCAGCTGG + Intronic
1133226573 16:4343591-4343613 ACAGTGTTTCTTCCTGAAGCCGG - Intronic
1133355939 16:5136900-5136922 ACAGTTTTGGTTGTTGCGGCTGG + Intergenic
1135071744 16:19358214-19358236 ACACAGTTGTTTGCTCCATCTGG + Intergenic
1135878774 16:26231535-26231557 ACAGTGCTGGTTGTTGCAGGTGG - Intergenic
1138323771 16:56143081-56143103 ATAATGTTATTTGTTGCAGCAGG + Intergenic
1138525827 16:57606767-57606789 ACAGGGCTGTTTGCTGCCACTGG + Intergenic
1140254279 16:73321498-73321520 ACAATGCTGTATGCTGCAACTGG - Intergenic
1140590752 16:76349437-76349459 CCAGTGTTGTTTGTTTCAGCTGG - Intronic
1140812380 16:78590886-78590908 ACAGTGTCCTTTGTAGCAGCTGG - Intronic
1141077467 16:81020566-81020588 AGAGTGTTGTTATCTGCAGATGG + Intronic
1141954086 16:87358654-87358676 ACAGTGTTGTTCTCTCCAGCAGG - Intronic
1142807672 17:2379989-2380011 GCAGTTTTGGTTGCTCCAGCTGG - Exonic
1143272086 17:5683369-5683391 ACAGAGTGGTTTGCTAGAGCAGG - Intergenic
1143678123 17:8452559-8452581 ACAGAGTTGTGAGCAGCAGCAGG + Intronic
1146758708 17:35456158-35456180 ACAGTCTTCGTTTCTGCAGCTGG - Intergenic
1146836574 17:36115530-36115552 ACAGTGCTCATTTCTGCAGCTGG - Intergenic
1148046498 17:44748159-44748181 ACAGTGCTGGTTGCTGCGGCAGG + Intronic
1149879742 17:60277268-60277290 AAAGAGTTGTTGTCTGCAGCTGG - Intronic
1150626954 17:66848008-66848030 AGAGTGTTGTTTCCTGGAGAAGG + Intronic
1153715726 18:7846125-7846147 CCAGTAGTGTTTGCTGCAGCTGG + Intronic
1156101367 18:33599645-33599667 ACAGTGTCCTTTTTTGCAGCAGG + Intronic
1157301618 18:46483742-46483764 ACACTTTTGTTTCCTGCAGGGGG - Exonic
1157333840 18:46722723-46722745 ACATTTTTGATTGCTGCAGCAGG - Intronic
1157441928 18:47718210-47718232 ACAATGCTGTGTGGTGCAGCAGG - Intergenic
1157900239 18:51507994-51508016 ACAGTGTTGGTTGCTGCTGCTGG + Intergenic
1158094848 18:53758714-53758736 ACAGTGTTCTTTGCTAAAACTGG + Intergenic
1158406103 18:57161046-57161068 ACAGTATTGTTTATGGCAGCTGG - Intergenic
1158925960 18:62260754-62260776 ATCCTGTCGTTTGCTGCAGCAGG + Intronic
1159225062 18:65523102-65523124 ACTGTCTTGGCTGCTGCAGCAGG - Intergenic
1159927606 18:74282765-74282787 ACAGTGTTATTTGCTGAGGTGGG + Intronic
1161810115 19:6466682-6466704 GCAGTGTTGGTGGCTGCAGCAGG - Intronic
1165014146 19:32868656-32868678 ACAGTGTTGGTTATTGCTGCAGG + Intronic
1168567385 19:57436099-57436121 ACAGCTATGTTTGATGCAGCAGG - Intronic
1168687466 19:58357452-58357474 CCAGTGTGGCTTGCTGCCGCTGG + Exonic
925398018 2:3550727-3550749 ACAGTAGTTTTTACTGCAGCAGG - Intronic
926827043 2:16915684-16915706 ACAGTCCTCCTTGCTGCAGCTGG - Intergenic
930181238 2:48360399-48360421 ACGTTGATGATTGCTGCAGCTGG - Intronic
935184219 2:100716897-100716919 ACAGTCTTTATTTCTGCAGCTGG - Intergenic
935639273 2:105275199-105275221 ACACTGCTGTTTTCTGGAGCAGG - Intronic
936924708 2:117724591-117724613 ACAGTTTTGGTTGTTACAGCTGG - Intergenic
937504862 2:122525767-122525789 ACAGTTTTGGTTGTTACAGCTGG - Intergenic
937852299 2:126646729-126646751 ACAGTCCTGGTTTCTGCAGCTGG + Intergenic
940544250 2:155062887-155062909 TCAGTGTTGCTTTCTGCTGCTGG + Intergenic
941347362 2:164386887-164386909 CCAGTGTTATTTGATGCAGTAGG - Intergenic
942552461 2:177133528-177133550 ACAGTCTTGTTTGTGGTAGCAGG - Intergenic
946527546 2:220537658-220537680 ACAGTCTTCGTTTCTGCAGCTGG + Intergenic
947277711 2:228412471-228412493 ACACTGATGCTTGCTGCTGCTGG - Intergenic
947663483 2:231887777-231887799 ACATTGGTGTTTGTTACAGCTGG + Intergenic
947693061 2:232157728-232157750 TCAGAGTTGGTTGCTGCTGCTGG + Intronic
948971278 2:241429251-241429273 TCAGTGTTGTTTACTACAGAAGG + Intronic
1169022327 20:2339580-2339602 ACAGTGTTGTTGGCTGCTGCAGG + Intronic
1170516277 20:17133628-17133650 AGAGTGTTTTTGGCTGTAGCTGG - Intergenic
1170982931 20:21231729-21231751 ACAGTGTTGTTAGAAGTAGCAGG + Intronic
1172214298 20:33224125-33224147 ACAGTTTTGATTTGTGCAGCTGG - Intronic
1172960219 20:38793856-38793878 ACAATTTTGTTTGCTGTCGCTGG + Intergenic
1175433739 20:58927778-58927800 ACAGCCTTGTTTGGTGTAGCAGG - Intergenic
1175701621 20:61142286-61142308 ACATTTTTGTTTGGTGAAGCAGG - Intergenic
1176068400 20:63212775-63212797 ACAGTTTTGCTTGCTACAACTGG + Intronic
1176907105 21:14514705-14514727 TCAGTGTTGTCTGCTGCCACTGG + Intronic
1179459223 21:41522428-41522450 ACAGGGTTCTTTGCTGGAGCTGG + Intronic
1182025224 22:27112806-27112828 ACAGTTGTCTTTGCTGCAGAGGG + Intergenic
1183521079 22:38296403-38296425 CCTGTGTTGTTGGCTGCACCGGG - Intronic
1185248015 22:49783579-49783601 ACTGTGTCGTCAGCTGCAGCAGG + Intronic
949169906 3:985666-985688 ACAGTGTTGGTCTCTGCTGCTGG + Intergenic
949495594 3:4628721-4628743 TCAGTGTTGCTTGTTGCAGTGGG + Intronic
953184789 3:40627981-40628003 AAAGTGGTCTTTGCTGCAGTGGG + Intergenic
955692889 3:61607438-61607460 ACAGTAGTGTTTGATGCATCTGG - Intronic
956307140 3:67837666-67837688 ACAGTCTTCGTTTCTGCAGCTGG - Intergenic
957060599 3:75478330-75478352 ACAGTTTTGGTTGTTGCAGCTGG + Intergenic
959820506 3:110729852-110729874 ACAGGGTTGTTTGTTGCTGGAGG - Intergenic
961292786 3:125861078-125861100 AGAGTTTTGGTTGTTGCAGCTGG - Intergenic
961894408 3:130155321-130155343 ACAATTTTGGTTGTTGCAGCTGG + Intergenic
962214798 3:133512012-133512034 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
967016736 3:185488986-185489008 CCAGTGTTGTTTTCTGATGCCGG + Exonic
967878797 3:194284598-194284620 ACCTTGTTCCTTGCTGCAGCAGG - Intergenic
968800522 4:2740455-2740477 ACAGTCCTGGTTCCTGCAGCTGG - Intergenic
969004499 4:4008400-4008422 ACAGTTTTGGTTGTTGCGGCTGG + Intergenic
969435066 4:7184457-7184479 CCTGTGTTGTGTGCTGCAGAGGG - Intergenic
969548710 4:7849705-7849727 ACAGAGTTGTGTGGGGCAGCTGG - Intronic
969748369 4:9091748-9091770 ACAGTTTTGGTTGTTGCGGCTGG - Intergenic
972126775 4:35777787-35777809 ACGCTGTTGTTTGCTACAGTAGG + Intergenic
972229117 4:37049798-37049820 ACAGAACTGTTTGGTGCAGCTGG - Intergenic
972806210 4:42531397-42531419 ACAGTCTTTGTTTCTGCAGCTGG - Intronic
973099691 4:46250432-46250454 AAAGTTTTCTTTGCTTCAGCTGG + Exonic
974746704 4:66087268-66087290 ACAGTCCTGGTTTCTGCAGCTGG + Intergenic
974786507 4:66624959-66624981 TCAGTGTTGGTTCCTGCTGCTGG - Intergenic
975347756 4:73313107-73313129 GCTGTGTTGATTGTTGCAGCAGG + Intergenic
976632000 4:87248220-87248242 CCAGAGTTGGTTCCTGCAGCTGG - Intergenic
977290884 4:95163065-95163087 ACAGTGATGTTCCCTGCAACTGG + Exonic
977337230 4:95714763-95714785 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
978627590 4:110704755-110704777 ACAGTTTTGTTTGTCGCACCTGG + Intergenic
985027424 4:185751949-185751971 ACAGTTTTGGTTGCCACAGCTGG + Intronic
987034325 5:14005108-14005130 ACTGAGTGGTTTGGTGCAGCTGG - Intergenic
988258290 5:28849476-28849498 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
989981274 5:50648677-50648699 GCAGTGTTCTTTGCTAAAGCTGG - Intergenic
992043328 5:72859338-72859360 ACATTTTTGGTTGCTACAGCAGG - Intronic
992047452 5:72908504-72908526 ACTGAATTGTTTGCTGCATCAGG - Intronic
992243236 5:74791880-74791902 ACAGTCCTGGTTTCTGCAGCTGG - Intronic
992560935 5:77952193-77952215 ACAGTCTTTTCTGCTGCAGATGG + Intergenic
993780806 5:92063325-92063347 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
993792053 5:92220927-92220949 ACAGTCCTCTTTTCTGCAGCTGG - Intergenic
994837214 5:104871232-104871254 ACAGTGCTCTTTTCTGCAACTGG - Intergenic
996164836 5:120211581-120211603 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
997570061 5:134920491-134920513 ACAGCTTTGTTTGTTTCAGCTGG - Intronic
1000332245 5:160215028-160215050 ACAGTGTTATTTGAGGCAACTGG - Intronic
1000730702 5:164830298-164830320 ACAGTGCTCATTTCTGCAGCTGG - Intergenic
1000899662 5:166897219-166897241 CCAGTTTTGTTTGCAGAAGCAGG + Intergenic
1001043643 5:168354811-168354833 ACAGTTTTGTGGCCTGCAGCAGG + Intronic
1002998257 6:2306789-2306811 ACAGTCCTGGTTTCTGCAGCTGG - Intergenic
1004751767 6:18569018-18569040 ACAGTGATGTGATCTGCAGCTGG - Intergenic
1005468823 6:26141809-26141831 ACAGTGTTGCTTGTGCCAGCTGG - Intergenic
1008193570 6:48490706-48490728 ACAGAATTCTTGGCTGCAGCTGG - Intergenic
1008996373 6:57664776-57664798 TCAGTGTTGCTTTCTGCTGCTGG - Intergenic
1009660564 6:66605995-66606017 TCAGTGTTGGTTGCTGCTGCTGG + Intergenic
1010323700 6:74541426-74541448 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1012511159 6:100003256-100003278 TCAGTGTTGGTTTCTGCTGCTGG + Intergenic
1014363129 6:120506319-120506341 ACAGTCCTGGTTTCTGCAGCTGG + Intergenic
1014380588 6:120735867-120735889 ACATTGTGGTTGGCTGCACCAGG - Intergenic
1015095323 6:129408681-129408703 TCAGTGTTGGTTTCTGCTGCTGG + Intronic
1015475883 6:133658417-133658439 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1016001321 6:139044242-139044264 ACAGTGATGTTTAGTGCAGATGG + Intergenic
1018095661 6:160385298-160385320 ACAGAGTTGTTCGGTGTAGCAGG + Intronic
1018478295 6:164165299-164165321 ACACTCTGGTTTGCTACAGCAGG + Intergenic
1020382075 7:7557567-7557589 ATATGCTTGTTTGCTGCAGCAGG - Intergenic
1020710594 7:11599396-11599418 ACGGTCTTCTTTTCTGCAGCTGG - Intronic
1024275276 7:47672061-47672083 ACAGTGTGGTTTGATGAATCTGG - Intergenic
1024884222 7:54123711-54123733 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
1028845126 7:95471727-95471749 ACAGTGGAGTTGACTGCAGCTGG + Intergenic
1029136873 7:98379257-98379279 ACAGTGTTCTCAGCAGCAGCAGG + Intronic
1033386307 7:140879663-140879685 TCAGTGTTGATGGCTGCTGCCGG + Intronic
1034717296 7:153255515-153255537 ACATTGTTGATTTCAGCAGCAGG + Intergenic
1035563363 8:625304-625326 GCAGTGGTTTATGCTGCAGCAGG + Intronic
1038193841 8:25348280-25348302 ACAGAGGTGCTTACTGCAGCTGG - Intronic
1039489926 8:37939833-37939855 ACAGTGTTCCCTGCTGCAGGGGG - Intronic
1040116594 8:43628274-43628296 AAAGTTTTGTTTGATTCAGCAGG + Intergenic
1049510984 8:143026565-143026587 ACAGTGTTGGTGTCTGAAGCAGG + Intergenic
1050166818 9:2773267-2773289 ACACAGTGGTGTGCTGCAGCTGG + Intronic
1053828510 9:42050254-42050276 ACAGTGATGTTTTCTGAAACAGG - Intronic
1054602051 9:67137200-67137222 ACAGTGATGTTTTCTGAAACAGG + Intergenic
1056734891 9:89201182-89201204 ACTGTGTTGTTTCCTGTAGGAGG + Intergenic
1059202181 9:112428409-112428431 AGAGTGTTGTTTTTTGCAGTGGG + Intronic
1060032896 9:120230991-120231013 ACAGTGTGGATGGCAGCAGCTGG - Intergenic
1061272897 9:129553770-129553792 ACAGGGTTTTTTGTTGCTGCAGG + Intergenic
1062726626 9:138077743-138077765 ACAGTTTTGGTTGGAGCAGCTGG + Intronic
1188358066 X:29216914-29216936 ACAGTGGGTTGTGCTGCAGCTGG + Intronic
1189911613 X:45815878-45815900 ACACTGTGGGTTGCTGAAGCAGG + Intergenic
1190433849 X:50404159-50404181 AAAGGGTTGTTTTCTGCTGCAGG + Exonic
1190996623 X:55616554-55616576 TCAGTGTTGGTTTCTGCTGCTGG + Intergenic
1191588225 X:62851943-62851965 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1191729024 X:64314292-64314314 GCATGCTTGTTTGCTGCAGCAGG + Intronic
1192673128 X:73167476-73167498 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
1192688681 X:73335153-73335175 ACAGAGCTGATTGCTGCTGCAGG - Intergenic
1194082099 X:89481256-89481278 ACAGTGCTCATTTCTGCAGCTGG - Intergenic
1195893013 X:109716544-109716566 GCAGTGTTGTTTGTAACAGCTGG - Intronic
1196608629 X:117685378-117685400 ACAGTGTTGTTTTCTGCCCATGG - Intergenic
1197379876 X:125726958-125726980 ACAGTGTTGGTCTCTGCTGCTGG + Intergenic
1197409196 X:126095512-126095534 ACAGTGTTGGTCTCTGCTGCTGG + Intergenic
1197477234 X:126940499-126940521 ACAGTGTTGGTCTCTGCAACTGG + Intergenic
1198078659 X:133218045-133218067 ACAGGGATGTTTGATGCTGCTGG + Exonic
1198548550 X:137719921-137719943 ACACAGTTGCTAGCTGCAGCAGG + Intergenic
1200434771 Y:3137446-3137468 ACAGTGCTCATTTCTGCAGCTGG - Intergenic