ID: 1089614538

View in Genome Browser
Species Human (GRCh38)
Location 11:119687801-119687823
Sequence CATCCCAGGAGGGGCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089614530_1089614538 10 Left 1089614530 11:119687768-119687790 CCTGTTTGGAAGCAGAGGGTTCT 0: 1
1: 0
2: 1
3: 12
4: 146
Right 1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG 0: 1
1: 0
2: 6
3: 43
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089614538 Original CRISPR CATCCCAGGAGGGGCCTGTG GGG Intronic
900156316 1:1204664-1204686 CGTCCCAGGTGGGGCGTCTGGGG + Intronic
900320553 1:2081471-2081493 ACCCCCAGAAGGGGCCTGTGTGG + Intronic
900463335 1:2811594-2811616 CATCCACAGAGGGGGCTGTGTGG + Intergenic
900466969 1:2830441-2830463 CATCCTCGGAGCTGCCTGTGTGG + Intergenic
900511256 1:3062185-3062207 CATCAAAGCAGGGGCCTGAGTGG - Intergenic
900556841 1:3284916-3284938 CAGCCCAGGAAGGGCCAGCGTGG - Intronic
900808102 1:4781158-4781180 CATCCCAGGAGTGGACAGCGAGG - Intronic
901451772 1:9340266-9340288 CAGCAGAGGAGGGGCCTGGGGGG + Intronic
901626671 1:10628873-10628895 AATTCCAGGAGGGACCTGGGAGG - Intronic
902149207 1:14429247-14429269 AGACCCAGGAGGGCCCTGTGGGG - Intergenic
902256391 1:15191509-15191531 CTTCCCAGCAGGGGCCTCTGGGG - Intronic
903189496 1:21648888-21648910 CTTCCCAGGAGGGCTCTGCGGGG + Intronic
904334102 1:29785819-29785841 CTCCCCAGCAGGGGCCTGAGAGG - Intergenic
904388744 1:30165006-30165028 CATCCCTGGAAGGGCCGGTCAGG + Intergenic
906142273 1:43540806-43540828 CAGGGAAGGAGGGGCCTGTGGGG - Intronic
907527734 1:55063591-55063613 CATCCCAGGATGGGTGTCTGGGG + Exonic
909810052 1:79922531-79922553 AATCCCAGGAGAGGGCAGTGAGG - Intergenic
911050533 1:93667182-93667204 CATCCCAGCAAGGGCCTCAGTGG + Intronic
912948650 1:114105502-114105524 CTTCCCAGGAAGGGCCTGGCTGG + Intronic
913138525 1:115916482-115916504 CATCGCAGGAGGCGCCTGGCAGG + Intergenic
914328156 1:146641155-146641177 CCTCCCCGGAAGGGCCTGAGTGG + Intergenic
915441157 1:155946267-155946289 CATCCCTGTTGGAGCCTGTGGGG - Intergenic
916075642 1:161198587-161198609 CATCCCGGGAGGGGCTTGGCAGG - Exonic
918124184 1:181568297-181568319 CGCCCCAGGAATGGCCTGTGGGG + Intronic
918245594 1:182656753-182656775 CCTCCCAGGAAGGGCCCATGAGG - Intronic
919899756 1:202035079-202035101 CACCCCAGGACGGGCCTTTGAGG - Intergenic
919934544 1:202242942-202242964 CATCCCAGAAGAGTACTGTGAGG - Intronic
921041773 1:211439698-211439720 CAACCCAGGAGGTGCCTTTGAGG - Intergenic
921985375 1:221306607-221306629 CATTCCAGGTGGGGACTGTATGG - Intergenic
922618245 1:226976021-226976043 CATCGCAGCAGGGGGCTGTTGGG - Intronic
922795211 1:228336367-228336389 CTGCTCAGGAGGGGCCTCTGAGG - Intronic
924583904 1:245345264-245345286 TCTCCCAGGAGTGGCCTCTGGGG - Intronic
1062855384 10:777458-777480 CACGCCAGGGGAGGCCTGTGGGG - Intergenic
1062963241 10:1589394-1589416 CATCCACGGAGGGGCGTCTGCGG + Intronic
1063447450 10:6128285-6128307 CATCCAAGCAGGGCCCTGGGCGG - Intergenic
1064978019 10:21138277-21138299 CATCCAAGGAATGGCCTCTGAGG + Intronic
1067296245 10:44976677-44976699 CATGCCATGAGGCCCCTGTGTGG + Exonic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1069784900 10:70981605-70981627 CCTGCCAGGAGGGGCCTGTGGGG - Intergenic
1070544716 10:77443138-77443160 CATCCCACGAGGGGCCAGACTGG + Intronic
1070804786 10:79264676-79264698 CACCTCCGGAGGGGCTTGTGAGG + Intronic
1070888942 10:79927908-79927930 CACCTCATGAGGGGCCTGTAAGG - Intergenic
1073056950 10:100709306-100709328 CAGCCTAGGGTGGGCCTGTGGGG + Intergenic
1073494586 10:103879720-103879742 CAGCCCAAGAGGGGCCAGGGCGG + Intergenic
1075182032 10:120220283-120220305 CATTCAAGGAGAGGCCTGTTGGG - Intergenic
1075816039 10:125265475-125265497 CACCCCAGGTGGGTCCTGTGAGG + Intergenic
1076132349 10:128022201-128022223 CGACTCAGGAGGGGCCTGGGTGG - Intronic
1076594816 10:131618972-131618994 CAGCCTGGGAGGGGCCCGTGGGG + Intergenic
1076745276 10:132509808-132509830 AAGCTCAGGAGGGCCCTGTGTGG - Intergenic
1077130488 11:969818-969840 CATCACAGCAGGGCCCTCTGTGG + Intronic
1077178612 11:1202566-1202588 CATCCCAGGAGTGGGCAGAGGGG + Intergenic
1077328748 11:1974801-1974823 GATCCCAGCGGGGGCCTGTGGGG + Intronic
1077404761 11:2377951-2377973 CAGCTAAGGAGGGGCCTGCGCGG + Intronic
1077500647 11:2908422-2908444 CATCCCAGGGGGGTCCGGTGTGG - Intronic
1078171705 11:8933250-8933272 GATCCCAGGAGACTCCTGTGAGG + Intergenic
1078418769 11:11189385-11189407 CATCAGAGGAGGGGCCTGGTGGG - Intergenic
1078551226 11:12281667-12281689 CATCCCAGGATGACCCTGTGGGG + Intronic
1078643684 11:13118855-13118877 GATCCCAGATGGGACCTGTGTGG - Intergenic
1079677143 11:23243423-23243445 TATACCAGGAGAGGCCTGAGTGG + Intergenic
1081475203 11:43422861-43422883 TATAGCTGGAGGGGCCTGTGGGG + Intronic
1081695400 11:45105870-45105892 CACCCCTGGAGAGGCCTCTGTGG - Intronic
1082097300 11:48141362-48141384 CATCCATGGAGGGTCCTGTGGGG + Intronic
1082769085 11:57191871-57191893 CAGCCATGGAGGGGCATGTGTGG + Intergenic
1084273878 11:68042248-68042270 CCTCTCAGGAGGAGCCTGTGGGG + Intronic
1084444115 11:69193532-69193554 AAACCCTGGTGGGGCCTGTGTGG + Intergenic
1085736232 11:79041620-79041642 CATCCAAAGAGTGGCCTTTGGGG + Intronic
1086890754 11:92255213-92255235 AACCCAGGGAGGGGCCTGTGAGG - Intergenic
1088459267 11:110065322-110065344 CCTCCCAGGAGGTGGTTGTGGGG - Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089189634 11:116644500-116644522 CATCCGGGGAGGGGCGGGTGGGG + Intergenic
1089276954 11:117343579-117343601 CATTCCAGCAGGGGCCTCAGAGG - Intronic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1089752415 11:120661001-120661023 CATCCCTGGAGGGGCGGGTCTGG + Intronic
1090340891 11:126019221-126019243 CATTCCAGTAGGGGTATGTGGGG + Intronic
1090931023 11:131298107-131298129 GATACCAGGAGGGGCATCTGAGG - Intergenic
1091192203 11:133705467-133705489 CACCCCAAGAGGTGGCTGTGGGG - Intergenic
1202811727 11_KI270721v1_random:29980-30002 GATCCCAGCGGGGGCCTGTGGGG + Intergenic
1091693982 12:2615946-2615968 CGGCCCAGGTGGAGCCTGTGTGG - Intronic
1091746301 12:2995152-2995174 CATCTGAGGAGAAGCCTGTGAGG + Intronic
1094198953 12:27778759-27778781 CATCCCAGGAAGGGGGTGGGGGG - Intergenic
1094415770 12:30213322-30213344 CTTCCCAGGAGAGGCCTCAGGGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1095221339 12:39619849-39619871 CAGCCAATGAGGGGCCTGGGAGG - Intergenic
1096606488 12:52769975-52769997 CACCCCAGGAGGGCCCATTGTGG - Intronic
1096898247 12:54846761-54846783 CATCATAGGAAGTGCCTGTGAGG + Intronic
1097013232 12:55967546-55967568 CCTCCCCAGAGGGGCCAGTGAGG - Intronic
1098232801 12:68390123-68390145 CATCCCAGCAGTAACCTGTGTGG + Intergenic
1098971704 12:76863885-76863907 TATCCCAGGAGGTGCTTTTGGGG - Intronic
1101787047 12:107893340-107893362 CAGGCCAGGCGGGGACTGTGAGG + Intergenic
1104589907 12:130075862-130075884 AGTCCCAGCGGGGGCCTGTGAGG - Intergenic
1104807535 12:131599062-131599084 CATCCCAGGAGGGGAGTGGAGGG - Intergenic
1104812705 12:131628363-131628385 CCTCCCAGGACGTGCCTCTGGGG + Intergenic
1105068358 12:133218840-133218862 CACCCCAGGAGGAGCGGGTGTGG - Exonic
1106023231 13:25933981-25934003 CATTCTAGGAGGGGCCTGCATGG - Intronic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1108526000 13:51286547-51286569 CATCCCTGAAGGTGGCTGTGGGG + Intergenic
1110017619 13:70427648-70427670 AATCCCAGGAGGGACCTGGTGGG - Intergenic
1113821875 13:113220433-113220455 TATCTCAGGAGGCGCCTGTGAGG + Intronic
1113982864 13:114290544-114290566 CCTCTGAGGTGGGGCCTGTGGGG + Intronic
1118495731 14:66306513-66306535 CATCCCAAGATGGGACTTTGGGG + Intergenic
1118596007 14:67436246-67436268 CAGGCCAGTAGGCGCCTGTGTGG + Intergenic
1119438857 14:74614717-74614739 CCTCGCTGGAGTGGCCTGTGTGG - Intergenic
1119481810 14:74962690-74962712 CATCTCAGGGGCGGGCTGTGTGG + Intergenic
1119786822 14:77320617-77320639 CGTCCCCGGAGGGGCCGCTGTGG - Exonic
1121803910 14:96797667-96797689 CATCCCCGGGGGCGCCTGCGGGG - Intronic
1122429966 14:101634484-101634506 CTTCCCAGGAGGCTGCTGTGGGG + Intergenic
1122872053 14:104643319-104643341 GATCCCAGAAGGGGGCTCTGGGG - Intergenic
1122918372 14:104869197-104869219 CAGGCCAGGATGGGCCTATGGGG - Intronic
1122919563 14:104874453-104874475 CTTCCCAGGGAGGGCATGTGGGG + Intronic
1123998200 15:25733558-25733580 CAGGTCAGGAGGGGCCTCTGGGG - Intronic
1125482887 15:40092769-40092791 TTTCCCAGGAGAGGCCTGGGGGG + Intronic
1127221789 15:56887580-56887602 CAGCCTGGGAGGGGCGTGTGGGG + Intronic
1128511343 15:68315795-68315817 CAAGCCAGCAGGGGGCTGTGGGG - Intronic
1129703561 15:77781930-77781952 CTTCCCATGCGGGGCCTCTGAGG - Intronic
1130303725 15:82699333-82699355 CACTCCAGTGGGGGCCTGTGGGG + Intronic
1131506758 15:93026427-93026449 CATCGCAGGGCTGGCCTGTGTGG + Exonic
1132029143 15:98426520-98426542 CTTCCGAGGAGGGGCAGGTGGGG - Intergenic
1132383877 15:101386289-101386311 CATCCCAGCAGGTGCCACTGGGG - Intronic
1132645429 16:997285-997307 CTTCCCTGAAGGGGCCAGTGTGG - Intergenic
1132661583 16:1063726-1063748 CATCCCTGGCGGGGCATCTGCGG + Intergenic
1132911805 16:2317577-2317599 CACCCCAGGAGGGCCCTCTTGGG - Intronic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1133461281 16:5988695-5988717 CATCCCAGGAAGTGCCTGTCAGG + Intergenic
1134249844 16:12566532-12566554 CATGACAGGAGGGGGTTGTGAGG + Intronic
1134618123 16:15667556-15667578 CATCTCTGGAAGGGCCTGTGCGG + Intronic
1135556447 16:23440924-23440946 CATGGCAGGAGGGGACTGAGAGG + Intronic
1136076946 16:27823689-27823711 CATCGCAGGAGGGGCAGGTGAGG - Intronic
1136284280 16:29232146-29232168 CAGCCCTGGAGTGGACTGTGGGG + Intergenic
1136573320 16:31109269-31109291 GGTCCCAGGAGGGGCCGGAGCGG - Exonic
1137459691 16:48649382-48649404 CCTGCCAGGAGGGGCCTGCAGGG + Intergenic
1137691478 16:50430976-50430998 CATCCCCTGAGGGAGCTGTGGGG - Intergenic
1137938632 16:52658961-52658983 CCTGCCAGGAGGGGCCCATGAGG - Intergenic
1138648127 16:58440018-58440040 CACCCCCTGAGGGGCCTTTGAGG + Intergenic
1139468836 16:67167615-67167637 CTGCCCCTGAGGGGCCTGTGGGG + Intronic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1139798185 16:69499806-69499828 GTCCCCAGGAGGGGGCTGTGTGG + Intergenic
1140005406 16:71069792-71069814 CCTCCCCGGAAGGGCCTGAGTGG - Intronic
1141194385 16:81849037-81849059 GATGCTTGGAGGGGCCTGTGTGG + Intronic
1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG + Intronic
1141702534 16:85649060-85649082 CAACCCAGGAGAGGCCTCTGGGG - Intronic
1142089314 16:88201652-88201674 CAGCCCTGGAGTGGACTGTGGGG + Intergenic
1142276676 16:89122395-89122417 AATCCCAGGAGAGGCATGTCAGG - Intronic
1142504239 17:352732-352754 CCTCCCTGGTGGGGCCTGTCTGG - Exonic
1142611505 17:1111129-1111151 GAACACAGCAGGGGCCTGTGGGG - Intronic
1142648417 17:1329965-1329987 CATCTCAGGGGGGTCCAGTGTGG + Intergenic
1143175535 17:4952903-4952925 CAGCGCAGAAGGAGCCTGTGTGG + Intronic
1143286236 17:5791241-5791263 CTTCTCAGGAGGAGTCTGTGTGG + Intronic
1143838259 17:9710130-9710152 CATGACAGGAGGGGGGTGTGGGG + Intronic
1144892502 17:18502034-18502056 CAGCCCAGGAGGGGCAACTGAGG - Intergenic
1145139712 17:20442254-20442276 CAGCCCAGGAGGGGCAACTGAGG + Intergenic
1147556251 17:41481028-41481050 GAGCCCAGGAGGGGCCAGTGGGG - Exonic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1150248050 17:63690726-63690748 CAGCCCAGGAAGGAGCTGTGGGG + Intronic
1150456211 17:65308854-65308876 CCTCCCAGAAGCAGCCTGTGGGG - Intergenic
1151183086 17:72343697-72343719 GATCCCAGGAGGAGCATGTGGGG - Intergenic
1151453391 17:74212691-74212713 CAGGCCAGGAGGGGGCTCTGGGG - Intergenic
1151942605 17:77301995-77302017 CATCACAGGTGGGGTCTGTAAGG + Intronic
1152231069 17:79114445-79114467 CAGCCCAGGAGGTGGCTGGGTGG + Intronic
1152472977 17:80500478-80500500 CTTCCCAGGGGCTGCCTGTGGGG + Intergenic
1152701470 17:81821913-81821935 CCCACCAGGAGGCGCCTGTGGGG + Intergenic
1152736944 17:82001679-82001701 CAGGCCAGAAGGGGCCAGTGGGG - Intronic
1153155664 18:2146149-2146171 CATCTCATGAATGGCCTGTGAGG - Intergenic
1153546406 18:6210264-6210286 CCTACCTGGAGGGTCCTGTGTGG - Intronic
1154198273 18:12281745-12281767 CATCTCAGGGGAGGCCTGGGTGG - Intergenic
1155932749 18:31724285-31724307 CATGTGAGGAGGGGCCCGTGGGG - Intergenic
1156370404 18:36467525-36467547 CACTCCAGGAGGGTGCTGTGAGG + Intronic
1157598166 18:48876319-48876341 CGCCACAGGAGGGGCCAGTGAGG - Intergenic
1160532604 18:79574298-79574320 TGTCCCAGGAGGACCCTGTGCGG + Intergenic
1160840291 19:1143719-1143741 CCTCTCATGAGGGCCCTGTGAGG + Intronic
1161116680 19:2500957-2500979 AATCCCACGAGGGGCCTGGGAGG - Intergenic
1161262893 19:3347243-3347265 GATCCCAGGTGGTGCCTGGGAGG - Intergenic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1161655547 19:5512243-5512265 CTTCCCTGGTGGAGCCTGTGAGG - Intergenic
1161724795 19:5922487-5922509 GATGCCAGGAGGGGACGGTGGGG + Intronic
1161739061 19:6009219-6009241 CAACCCAGGAGGGTTCTGTTTGG + Intronic
1162031247 19:7918104-7918126 CAGCCCAGGAGGTCCCAGTGAGG + Exonic
1163811199 19:19432909-19432931 CATCCCAGTAGAGGACAGTGTGG + Intronic
1164038635 19:21474995-21475017 CGACCCAGGAGCGGACTGTGGGG - Intronic
1164548142 19:29186041-29186063 CATACCAGGAGGGTCCAGGGTGG + Intergenic
1165093743 19:33399674-33399696 CATCCCAGCAACGGGCTGTGGGG + Intronic
1166075207 19:40410234-40410256 CATGCCAGGTGGGGGCTGTGAGG - Intronic
1166120081 19:40681054-40681076 GATCCTAGGAGGGGCCGGGGAGG + Exonic
1166359598 19:42247680-42247702 CCTCCCAGCTGGGGCCTCTGGGG - Exonic
1166580598 19:43895263-43895285 CATCCCAGGATGGGGCTGTTGGG - Intronic
1167011725 19:46813190-46813212 CCTCCCAGGAGGGGCCTGGAGGG + Intergenic
1167302343 19:48685491-48685513 CAGCCCAGGATGGGACTGGGTGG - Intergenic
1167424395 19:49422614-49422636 CCCCCCAGGACGGGCCTGGGCGG - Exonic
925390912 2:3493315-3493337 CCCCCAAGGAGGGGCGTGTGAGG - Intergenic
926152693 2:10433833-10433855 CATTCCAGGAGGGCCAGGTGGGG + Intergenic
926175828 2:10591359-10591381 CACCCCAGGAGGGGCCCTGGGGG + Intronic
926912530 2:17864422-17864444 CATCCCACCAGAGGCCAGTGTGG + Intergenic
927971817 2:27310403-27310425 CACCCTATGAAGGGCCTGTGTGG + Intronic
928438092 2:31268955-31268977 CCACCCAGGAGAGACCTGTGAGG + Exonic
928996500 2:37297598-37297620 CAGCCCAAAAGGGGCCTATGGGG - Intronic
930035096 2:47080290-47080312 CAGGACAGGAGGGGCCTCTGTGG - Intronic
932813863 2:74845909-74845931 CTTCCCAGGAGGAGTCTGTGAGG + Intronic
934614810 2:95764357-95764379 GATCCCATGAGGGGCCAGTGTGG - Intergenic
934646093 2:96060137-96060159 GATCCCATGAGGGGCCAGTGTGG + Intergenic
934839496 2:97616220-97616242 GATCCCATGAGGGGCCAGTGTGG + Intergenic
935066516 2:99652960-99652982 CATCCCTGGAGGTGTCTGCGTGG - Intronic
936175017 2:110212237-110212259 CATGGCAGGCGGGGACTGTGTGG + Intergenic
936246877 2:110836189-110836211 CAGCCCTGGAGGGGGCTGTTGGG + Intronic
937349866 2:121153926-121153948 CAGCTCTGGAGGGGCCTGGGCGG + Intergenic
938101282 2:128499657-128499679 CATCCCAGCAGGGGCCACCGAGG + Intergenic
939078248 2:137628658-137628680 CATCCCAGCAGTGGCCCTTGAGG - Intronic
940846751 2:158650645-158650667 CTTCCTAGGAGGGAGCTGTGTGG - Intronic
944371070 2:198984747-198984769 CGTCGCAGGAGGGGCCTGGTAGG - Intergenic
946494937 2:220186634-220186656 CAGAGCAGGAGGGGACTGTGAGG - Intergenic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948661426 2:239508923-239508945 CAGCCCAGGAGAGGCCAGGGAGG - Intergenic
948770661 2:240249951-240249973 CCTCCCAGGCTGGCCCTGTGTGG - Intergenic
948907505 2:240986817-240986839 ACTCCCAGAAGGGGGCTGTGAGG - Intronic
1168926662 20:1587368-1587390 CATCACAGCAGGGCCCAGTGGGG + Intronic
1168930363 20:1618644-1618666 CATCACAGCAGGGCCCAGTGGGG + Intronic
1169420747 20:5457267-5457289 CACACCAGGTGGGGCCTGTTGGG - Intergenic
1169469383 20:5871025-5871047 GATCCCAGGAGGAGCTTGTAAGG - Intergenic
1169789433 20:9393506-9393528 CAGTCCAGGAGGAGCCTGGGAGG - Intronic
1169925591 20:10781045-10781067 CATCAAAGGAAGGGCTTGTGCGG + Intergenic
1170781274 20:19427684-19427706 CAGCCCAGGACAGGCCTGGGAGG - Intronic
1170873605 20:20231321-20231343 CTTCCTAGGAGGAGCCTGTTGGG + Intronic
1172175133 20:32967582-32967604 CATCCCAGGTAGGGCCTGGGTGG - Intergenic
1172481598 20:35274893-35274915 CATGCCAGGAGGAGCCCCTGTGG + Exonic
1173094439 20:40011544-40011566 GATCCCAGGAGGGGACAATGAGG - Intergenic
1173141563 20:40489397-40489419 CATACAAGGAGGGGAATGTGGGG + Intergenic
1173372342 20:42448282-42448304 CATCCAAGGGGGGCCCTTTGAGG - Exonic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1173947190 20:46960937-46960959 CATCCCAGGAGGTGCCTGGGAGG + Intronic
1174414938 20:50360289-50360311 TACCCCAGGAGGGGCGGGTGAGG - Intergenic
1174416405 20:50370004-50370026 CTTCCCAGCATGGGTCTGTGTGG + Intergenic
1174453334 20:50632921-50632943 CAGCACAGGAGGGGACTGTAGGG - Intronic
1175283345 20:57820141-57820163 CATCCCATGGGAGGCCTGGGAGG + Intergenic
1175636808 20:60591328-60591350 CTCCCCAGGAGGTGCCTGCGTGG + Intergenic
1175889960 20:62311677-62311699 CCTCCCAGGAGGAGCCTCGGGGG + Exonic
1175967204 20:62665677-62665699 CAGGCCAGGATGGGCCTGTGGGG - Intronic
1176014146 20:62920222-62920244 CATCCCAGCAGGGTACTGTGGGG + Intronic
1176033403 20:63024763-63024785 CCTCTCAGAGGGGGCCTGTGAGG + Intergenic
1176093539 20:63329395-63329417 GAGCCCAGGAGGCGCCTGTGTGG + Intronic
1176093714 20:63330068-63330090 AGTCCCAGGAGGGGCCTGTGAGG + Intronic
1176108158 20:63399173-63399195 CATCCTTGGAGGGGGCCGTGGGG + Intergenic
1176108168 20:63399198-63399220 TGTCCCTGGAGGGGGCTGTGGGG + Intergenic
1176603638 21:8813179-8813201 AATCCCAGGAGGGGCAGTTGAGG - Intergenic
1177169740 21:17641805-17641827 CCTCCCAGGTGGGGCCTGTTGGG - Intergenic
1179419724 21:41225812-41225834 CATGCCAGGAGGAGGCTGGGAGG + Intronic
1179603538 21:42496774-42496796 CATCCCCGGAGGGGCCTGCGAGG - Intronic
1179770511 21:43611937-43611959 CATCCCAAGTTGTGCCTGTGTGG + Intronic
1179802676 21:43818614-43818636 GATCACAGGAAGTGCCTGTGTGG - Intergenic
1180144885 21:45913502-45913524 CATCCCAGGAGGGGCCCCGGTGG + Intronic
1180160453 21:45996816-45996838 CATCTCATGAGGACCCTGTGGGG - Intronic
1180161708 21:46001164-46001186 CAGCCAAGGAGGGGCCAGGGCGG + Intronic
1180345921 22:11704730-11704752 AATCCCAGGAGGGGCAGTTGAGG - Intergenic
1180787811 22:18556762-18556784 CATGGCTGCAGGGGCCTGTGGGG + Intergenic
1180840491 22:18956816-18956838 CATGGCAGGAGGGGGCTGGGTGG - Intergenic
1180995733 22:19964382-19964404 CATTCCAGTAGAGCCCTGTGTGG + Intronic
1181967426 22:26666852-26666874 TCTTCCAGGATGGGCCTGTGGGG + Intergenic
1182163315 22:28145880-28145902 CATCTCATGAGGTGGCTGTGAGG - Intronic
1182332451 22:29560904-29560926 CTTCACAGGAGGGGCCTAGGTGG + Intronic
1182518760 22:30873441-30873463 CTTCCCAGGAGGGGCCCTGGTGG - Intronic
1183335565 22:37244071-37244093 CATCCCAGTTGGGGGCTGTGAGG + Intronic
1184714614 22:46273786-46273808 CGTCCCAGGAGGGGCCAGCCAGG - Intronic
1185031607 22:48446408-48446430 CATCCCTGGAGGGGGTTGGGGGG - Intergenic
1185285453 22:49997887-49997909 CAGACCAGGAGGGGGCTCTGAGG + Intronic
949982356 3:9509700-9509722 CATTCCCGGAGTGGCCTCTGGGG - Intronic
950502228 3:13371912-13371934 CATGCCCGGCGGGGCCAGTGAGG - Exonic
951620414 3:24595441-24595463 CATGCCAGCAGGACCCTGTGTGG + Intergenic
952934136 3:38382375-38382397 CCTTTCAGAAGGGGCCTGTGGGG + Intronic
953031377 3:39182134-39182156 CAGGCAATGAGGGGCCTGTGAGG + Intergenic
953347335 3:42187225-42187247 CATCACAGAATGGGGCTGTGTGG + Intronic
953906830 3:46872578-46872600 CAGGCGAGGAGGGGCCTGAGAGG - Intronic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
954971439 3:54654675-54654697 GCTCACAGGAGGGTCCTGTGGGG + Intronic
955807617 3:62753869-62753891 CATCCCAGGAGGAACCACTGTGG + Intronic
956519932 3:70092978-70093000 CATCCCAGGAGAGCCCCCTGAGG - Intergenic
956682835 3:71797512-71797534 CAGCCCAGGATGTGCCTGTCTGG + Intergenic
959974601 3:112444590-112444612 CATCCCAGAAGGACCCCGTGAGG - Intergenic
960967429 3:123114914-123114936 AATGTCAGGAGGGGGCTGTGGGG + Intronic
962235381 3:133702225-133702247 CAGAGCTGGAGGGGCCTGTGGGG - Intergenic
962384695 3:134923375-134923397 TATCTCAGCAGGTGCCTGTGTGG - Intronic
962754399 3:138457053-138457075 AAGCCCAGGAGGGTCGTGTGAGG - Intronic
966794255 3:183698393-183698415 CATCCCAGGGAGGCCCGGTGGGG - Intronic
966933690 3:184691891-184691913 CATTCCGGGAGGGCCCTGTCAGG + Intergenic
967977066 3:195041348-195041370 CATCCCCAGAAGGGCCTGAGAGG + Intergenic
968511024 4:996041-996063 CATCCCAGGTGGAGGCTATGGGG - Intronic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
968996756 4:3950742-3950764 CCTTCCAACAGGGGCCTGTGGGG + Intergenic
969421025 4:7095890-7095912 CATTGCAGCAGGTGCCTGTGAGG + Intergenic
969476510 4:7425259-7425281 GACCCCAGGACTGGCCTGTGTGG + Intronic
969556156 4:7911726-7911748 AATCCCTGGAGGGACCCGTGTGG - Intronic
978812111 4:112861098-112861120 GAGCCCAGGAGGTCCCTGTGAGG + Intronic
980771542 4:137379641-137379663 CATCCCAGCAGCTGCGTGTGGGG - Intergenic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
985674108 5:1221513-1221535 CATCCCAGGAGGGAGGTGGGTGG + Intronic
985885317 5:2673007-2673029 CATCCCATGAAGGGAATGTGTGG - Intergenic
986538444 5:8816657-8816679 TATCACAGGAGGGGCCTGGTGGG + Intergenic
986862678 5:11946487-11946509 CATCACAGGAGGCTCCTGTAAGG - Intergenic
989286641 5:39707481-39707503 TATCCCAGTAGGGTACTGTGGGG + Intergenic
990589938 5:57252143-57252165 CATCTCAAAAGGTGCCTGTGGGG - Intronic
998104123 5:139457495-139457517 CATCCAGGGAGGGCCCAGTGAGG - Intronic
999261083 5:150239294-150239316 CAGCTCAAGAGGGGCCTCTGTGG + Intronic
1001234260 5:170015998-170016020 CCTCCCAGGAGTGGACTGTAGGG - Intronic
1002189742 5:177472429-177472451 GATTCCAGGATGGGGCTGTGAGG + Intronic
1002270308 5:178067424-178067446 CATCCCAGGAGGGTCCTCTGTGG - Intergenic
1002377840 5:178801056-178801078 CATCCCTGGAGGGGTCAGTGAGG - Intergenic
1002640246 5:180627289-180627311 CATCACAGCAGGGGCCCGGGGGG + Intronic
1002667645 5:180837708-180837730 CATCCCAGAAGAGTCTTGTGGGG - Intergenic
1006839372 6:37018577-37018599 CTTCCCAGGCTGGCCCTGTGGGG - Intronic
1013175786 6:107675385-107675407 CGTCCGAGGAGGGGGCTGTCGGG + Intergenic
1015203017 6:130603637-130603659 CATCGCAGCAGAGCCCTGTGTGG + Intergenic
1016356788 6:143227306-143227328 CAGCCCAGCAGGGTCCTGTGTGG + Intronic
1017615689 6:156244185-156244207 CATCCAAGCAGGGGGCAGTGAGG - Intergenic
1018005724 6:159619930-159619952 CATCCCAGGAGGCACCTCTTTGG + Intergenic
1023867863 7:44247327-44247349 CTGGCCAGGAGGGGCCTCTGGGG + Intronic
1023997926 7:45173501-45173523 CATGCCTTGAGGTGCCTGTGGGG + Intronic
1024026060 7:45410794-45410816 CTTCCCAGAAAGGTCCTGTGAGG - Intergenic
1024246825 7:47477126-47477148 CATCCCAGGACAGGACTGTAAGG - Intronic
1025236991 7:57241193-57241215 CAACCCAGGAGAAGCCTGTATGG + Intergenic
1025254233 7:57372752-57372774 CTTCCCAGCATGGGTCTGTGTGG - Intergenic
1027255979 7:76431011-76431033 CATTCCAGGAGGGGCACCTGTGG - Intronic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1029452406 7:100648541-100648563 CAGCCAAGGTGGGGCCTCTGGGG - Exonic
1029779743 7:102719341-102719363 CATCTCAGGAGGAGCCTGCATGG + Intergenic
1029795878 7:102894104-102894126 CATCCCTGGACATGCCTGTGTGG + Intronic
1030112271 7:106037015-106037037 CCTCTCAGAAAGGGCCTGTGTGG - Intergenic
1032792308 7:135251561-135251583 CAACCCTGGAGGTGGCTGTGAGG - Intronic
1033277616 7:139984465-139984487 CAACCCAGGAGTGGCAGGTGAGG - Intronic
1034405308 7:150898928-150898950 CATCCCAGGTGGAGGCCGTGAGG - Intergenic
1034994745 7:155570725-155570747 CACTCGCGGAGGGGCCTGTGAGG - Intergenic
1035119003 7:156549368-156549390 GAGCCCAGGAGGGGACTGGGCGG - Intergenic
1035457995 7:159022046-159022068 CATCCCAGGATAGGGCGGTGAGG - Intergenic
1035602973 8:908492-908514 CATGGCAGGATGGGCGTGTGTGG + Intergenic
1035758493 8:2051750-2051772 CACCCCAGGGCGGGCATGTGCGG + Intronic
1036929654 8:12942710-12942732 CAGCCCAGGAGGGGACATTGAGG + Intergenic
1039507090 8:38059970-38059992 CCTCCCAGGAAGGCCCTGAGGGG - Exonic
1040432864 8:47361381-47361403 GCTCCCAGGAAGGGCCTGGGTGG + Intronic
1040452433 8:47561654-47561676 GATCCCAGGAGGGGCAGGGGTGG - Intronic
1040568442 8:48587457-48587479 CAACCCTGGTGGGGGCTGTGAGG + Intergenic
1040607629 8:48950247-48950269 TACCCCAGGAGGTGCCTGTTGGG - Intergenic
1048893320 8:138966788-138966810 CATCCCAGGTGAGGCATGAGTGG - Intergenic
1048907062 8:139098570-139098592 TGTCCCAGGAGGGGCCACTGGGG - Intergenic
1049385582 8:142341445-142341467 CATCCCAGGAGGGCCCTGGCAGG + Intronic
1049729135 8:144167068-144167090 CATCCCAGGAGGCACCTGCTGGG - Intronic
1052796952 9:32931571-32931593 CCTCCCAGGAGGGATCTGGGCGG - Intergenic
1053414958 9:37941651-37941673 CATCCCTGCAGGGGCCTGGCTGG + Intronic
1054456618 9:65434550-65434572 AGGTCCAGGAGGGGCCTGTGGGG - Intergenic
1054564561 9:66746299-66746321 CATCCGAGGAGGGACCTGGTGGG - Intergenic
1056773814 9:89497707-89497729 CGTCCCAGGAGGGGCCCCGGGGG + Intronic
1057020305 9:91692231-91692253 CAACTCTGGGGGGGCCTGTGAGG - Intronic
1057873318 9:98734073-98734095 CACCCCAGCGGGGGCATGTGTGG - Exonic
1058676614 9:107405582-107405604 TATGCCAGGGGTGGCCTGTGAGG + Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061677512 9:132226751-132226773 CCTCCCAGGAGGGGCCCAGGAGG - Intronic
1062216425 9:135392108-135392130 CCTCCCAGGATGGCCCTCTGTGG - Intergenic
1062281723 9:135754874-135754896 CCCCCCAGGAGGTGCTTGTGAGG - Intronic
1062282920 9:135759961-135759983 ACTCCCAGGAGGGGACAGTGAGG + Intronic
1062339001 9:136085586-136085608 AAGGCCAGGAGGGGCCTGGGAGG + Intronic
1062464206 9:136674014-136674036 CTTCCCAGGGAGGGGCTGTGGGG - Intronic
1062498047 9:136840817-136840839 AGGCCCAGGAGGGACCTGTGAGG + Exonic
1062567684 9:137170522-137170544 TATCCCAGGAGAGTCCTGGGGGG - Intronic
1062610426 9:137371067-137371089 CTTCGCAGAAGGGGCCTGTGCGG + Intronic
1062732411 9:138117540-138117562 CTTCCCAGGATAGTCCTGTGTGG + Intronic
1186461366 X:9751002-9751024 CATCCCAGGAGGATGCTCTGAGG + Intronic
1187562897 X:20419066-20419088 GCTCAGAGGAGGGGCCTGTGGGG + Intergenic
1188985019 X:36761429-36761451 CATGGGAGGAGGTGCCTGTGTGG - Intergenic
1194898386 X:99473981-99474003 CATCAGAGGAGGGGCCTGGTGGG + Intergenic
1196398162 X:115288380-115288402 CAGCCCAAGAGGAGCCTGGGAGG + Intergenic
1202605092 Y:26632593-26632615 CATCCCTGCCGGGTCCTGTGTGG - Intergenic