ID: 1089615444

View in Genome Browser
Species Human (GRCh38)
Location 11:119692285-119692307
Sequence GGCTGAGCTGCATCCGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089615444 Original CRISPR GGCTGAGCTGCATCCGCAGC TGG (reversed) Intronic
900102893 1:970399-970421 GGCTGTGCTGGAACCGCAGCTGG - Exonic
900147893 1:1166360-1166382 GGCTGAGCCGCCTCTGCAGGGGG - Intergenic
901377436 1:8849327-8849349 AGCTGAGCTGCACCTGCAGAAGG + Intergenic
901390284 1:8941256-8941278 GGCTGAGCGGCAGGAGCAGCTGG - Intergenic
902511633 1:16969877-16969899 GGCTGACCTGGAACTGCAGCGGG + Exonic
903071201 1:20727744-20727766 GGCTCTGCTGCTTCCCCAGCAGG + Intronic
903813176 1:26046058-26046080 GCCGGAGCTGCAGCCGCAGCGGG - Exonic
906473251 1:46148923-46148945 TGCTGGGCTGCATCCCCAGGAGG + Intronic
906627059 1:47333947-47333969 TGCTGAGCCGCTGCCGCAGCGGG + Exonic
906676891 1:47699683-47699705 GGCTGAGGTTGAGCCGCAGCTGG - Intergenic
908398430 1:63747495-63747517 GGCTGAGCTCCACACACAGCTGG - Intergenic
909668686 1:78164387-78164409 GGCTGAGCTGAGTCCCCTGCAGG - Intergenic
910588315 1:88902508-88902530 GGCTGAGTGGCATCCACAGAAGG - Intergenic
910773414 1:90851672-90851694 GGCGGACCTGCAGCCGCCGCGGG + Intergenic
915507746 1:156368206-156368228 GCCTGGGCTGCCTCTGCAGCTGG - Intergenic
918442007 1:184576894-184576916 GGCTCAGCTTCATCCCCTGCCGG + Intronic
920150244 1:203900453-203900475 GCCTTAGCTGCCTCCCCAGCAGG + Intergenic
923467412 1:234261670-234261692 TGCTGGGCTGCATCCCCAGGAGG - Intronic
1062820924 10:534095-534117 GCCTCTGCTGCATCCGCAGGAGG - Intronic
1063586796 10:7359298-7359320 ATCTGAGCTGCATCTGGAGCAGG + Intronic
1063665803 10:8059570-8059592 GGCTGAGCTGCAGCCAGAGGAGG + Intronic
1065102232 10:22341560-22341582 GGCTGACCGGCATCTGGAGCAGG + Intergenic
1065805998 10:29394383-29394405 CGCAGAGCTGCAGCCCCAGCCGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1075409512 10:122216962-122216984 GCCTGAGCTGCAAGTGCAGCGGG - Intronic
1075437824 10:122458684-122458706 GGGTGAGCTGCACTCACAGCTGG + Intergenic
1076692484 10:132230848-132230870 AGCTGAGCTGCATCGTGAGCAGG - Intronic
1076824880 10:132961787-132961809 GGCTGGGCTGCAAGTGCAGCGGG - Intergenic
1076892992 10:133293933-133293955 GGCTGAGTTCCAACCGCCGCAGG + Intronic
1077324149 11:1956479-1956501 GGCGGGGCGGCATCCCCAGCTGG + Exonic
1079125893 11:17718703-17718725 GGCTGAGCTGCCTCTTCAGCTGG - Intergenic
1079489007 11:20966690-20966712 GGCTCAGCTGCATCTCCTGCTGG - Intronic
1080113374 11:28594687-28594709 AGCTGAGCTGCATTCCCATCTGG - Intergenic
1081640354 11:44749055-44749077 GGCAGAGCTGGATCTGCACCTGG + Intronic
1082992095 11:59215866-59215888 GGCTGGGCTGCATTCCCAGAGGG - Intergenic
1083367266 11:62148756-62148778 GGCTGAGCGGCAGCTGCAGGAGG + Exonic
1083669391 11:64291756-64291778 GCCTCAGCCGCAGCCGCAGCGGG + Intronic
1083968749 11:66059386-66059408 GGCTGAGATGCATCCAGAGAGGG + Intronic
1084265414 11:68003152-68003174 GGATCAGCTGCATCTGCAGGAGG + Exonic
1084435778 11:69138507-69138529 GGCTGGGCTGCATCATCAGAAGG + Intergenic
1085258973 11:75193480-75193502 GGCACAGCAGCATCCCCAGCAGG - Exonic
1085698989 11:78729581-78729603 GGCTGAGCTACCTGAGCAGCCGG - Exonic
1085818614 11:79768817-79768839 GGCAGAGCTGCATCTGAAACTGG + Intergenic
1089615444 11:119692285-119692307 GGCTGAGCTGCATCCGCAGCTGG - Intronic
1090333058 11:125946094-125946116 GGCAGAGGTGTATCAGCAGCAGG - Intergenic
1202807135 11_KI270721v1_random:11674-11696 GGCGGGGCGGCATCCCCAGCTGG + Intergenic
1094501979 12:31029707-31029729 GGCTGAGAAGCAGCAGCAGCAGG - Intergenic
1095752721 12:45729412-45729434 GGCTGAGCTGCCTCAGCCGGCGG + Intergenic
1097288365 12:57894691-57894713 AGCTCAGCTGCATCCACAGGGGG - Intergenic
1101880516 12:108622841-108622863 GGCTGGGCTTCATCCGCGGAGGG + Exonic
1102223332 12:111209780-111209802 GGCTGAGCTGCACCCGGGACCGG - Intronic
1103981914 12:124742275-124742297 GGTGGAGCTGCACCCCCAGCGGG - Intergenic
1104616676 12:130276222-130276244 GGCTGAGCTGGACCCACAGTGGG - Intergenic
1104988325 12:132610160-132610182 GGCAGAGCTGGTTCCGCCGCAGG + Intronic
1105019162 12:132804986-132805008 GGCTGAGCTGCAGGCCCAGCTGG - Exonic
1105768913 13:23588990-23589012 GGCAGAGCTGCCTCCGCTGCAGG - Intronic
1107978535 13:45713376-45713398 CGCTGAGCTGCACCCGCGGCGGG - Exonic
1111470840 13:88680421-88680443 GGCTGAGTTGCATCCACAAATGG + Intergenic
1112387969 13:98957958-98957980 GGCAGGGCTGAATCCTCAGCTGG + Intronic
1113432793 13:110264993-110265015 GGCTGAGCTGCAGCAGCACTTGG - Intronic
1113582526 13:111439162-111439184 GGCTGAGCTGCAGACTCAGGAGG + Intergenic
1113810926 13:113141888-113141910 GGCTGAGCCGCACCTGAAGCCGG - Intronic
1113921761 13:113917301-113917323 GGCTGAGCTGCTTCCCCCGTGGG - Intergenic
1114789858 14:25645424-25645446 TGCTGAGCTGCATTCCCAGGAGG - Intergenic
1115506666 14:34099827-34099849 GGCTGAGCCGCAGCAGCTGCAGG - Intronic
1118049559 14:62012214-62012236 AGCTGGGCTGCATCCTCATCTGG + Intronic
1119192535 14:72692898-72692920 GGCTGAGCTGCAGGGGCAGCTGG + Intronic
1121260974 14:92565865-92565887 GGCTGGGCTGCATTCCCAGGAGG - Intronic
1121713096 14:96053611-96053633 GGCTGAGCCCCAACAGCAGCTGG + Intronic
1122036656 14:98954001-98954023 GGCTGAGCAGCTCCCGGAGCAGG + Intergenic
1122482618 14:102056879-102056901 GGCTGAGCTGCAGCGGGAGTTGG - Intergenic
1122601170 14:102922709-102922731 CGCAGAGCTGCAGCCACAGCAGG - Exonic
1122636724 14:103133442-103133464 GGCCGAGCAGCAGCAGCAGCTGG + Exonic
1122718046 14:103707045-103707067 GGCAGAGCTGCAGCGCCAGCTGG + Exonic
1124383118 15:29184521-29184543 GGCTGAGCTGCAGACTCAACTGG - Intronic
1124438928 15:29673335-29673357 TGCTGGGCTGCATCCCCAGGAGG - Intergenic
1129207125 15:74043978-74044000 GGGAGAGCTGGATCCCCAGCTGG + Intronic
1129537497 15:76326072-76326094 AGCTGGGCTGCATCCTCAGATGG - Intergenic
1129675617 15:77631429-77631451 GGCTGGGCTGCGACCCCAGCAGG + Intronic
1130675508 15:85948558-85948580 TGCTGAGCAGCATCAGCAGGAGG - Intergenic
1131012038 15:89026212-89026234 GGCTGGGCTGCATTCTCATCTGG + Intergenic
1131424440 15:92334153-92334175 GGCAGAGCTGCATTCGTAACTGG - Intergenic
1132288604 15:100683809-100683831 GCCTGGGCTGCATCTGCATCAGG + Intergenic
1132708184 16:1255326-1255348 ATCTGAGCTTCATCCGCAGAGGG - Intergenic
1133234442 16:4381387-4381409 GGCTGAGGTCCAGCAGCAGCAGG - Exonic
1136067714 16:27769989-27770011 GGCTCAGCTGCTGCCCCAGCCGG + Exonic
1136613747 16:31382773-31382795 GGGTGAGCTGCAGCCGCACCGGG - Exonic
1137710539 16:50563752-50563774 GGCTAAGCTCCATCCTCAGTGGG + Intronic
1139402955 16:66696681-66696703 GACCGAGCCGCAGCCGCAGCCGG - Exonic
1140188679 16:72796327-72796349 GGCTCAGCTACCCCCGCAGCTGG - Exonic
1140358004 16:74322178-74322200 TGCTGAGCTGCATTCCCAGGAGG + Intergenic
1141014643 16:80437651-80437673 GGCTGAGCCCCATCCCCAGCTGG + Intergenic
1141016679 16:80457391-80457413 GGCTGAGCTGAATTGGGAGCAGG + Intergenic
1141442077 16:84035812-84035834 GGCTAATCTGCAATCGCAGCTGG + Intronic
1141443799 16:84045497-84045519 TACTGGGCTGCATCTGCAGCCGG + Intergenic
1141659207 16:85432777-85432799 GGCTGGGATGCTTCAGCAGCAGG + Intergenic
1142712313 17:1730273-1730295 GGCAGAGCTGCAGCCGCAGGTGG + Intronic
1144825571 17:18103920-18103942 GGCTGAGCTTCATCCCTAGAAGG + Intronic
1147158938 17:38559650-38559672 GGTGAAGCTGCATCTGCAGCCGG + Exonic
1148050868 17:44769426-44769448 GGCTGGGCTGCAGGTGCAGCTGG - Intronic
1148340848 17:46872622-46872644 GGCAGAGCTGCTTCTGCCGCCGG - Exonic
1149530617 17:57392035-57392057 GGCTGCTCTGCATCTGCAGGCGG - Intronic
1150069297 17:62138376-62138398 GGCCGAGCTGCACCGGGAGCTGG - Intergenic
1150398189 17:64837089-64837111 GGCTGAGGGGCTGCCGCAGCCGG - Intergenic
1151986411 17:77546915-77546937 GGCTGAGCAGAAGCCACAGCGGG + Intergenic
1152491500 17:80637643-80637665 GGATGAGCTGCATGCTGAGCAGG + Intronic
1152572508 17:81126986-81127008 GGCTGGGCTGGATCCCCTGCTGG - Intronic
1152822484 17:82444400-82444422 GCCGGAGCTGCAGCCGTAGCAGG - Intronic
1154524867 18:15275612-15275634 GGCTGTGATGCATACACAGCTGG - Intergenic
1156908285 18:42381050-42381072 GGCTGTTCTGCAGCCTCAGCTGG - Intergenic
1159659412 18:71075453-71075475 GACTGGGCTGCATCCTCATCTGG - Intergenic
1160767702 19:815692-815714 AGCTGAGCAGCATCAGCAGCGGG + Exonic
1161074010 19:2276234-2276256 CGCTCAGCTGCAGCAGCAGCAGG + Exonic
1161083054 19:2321078-2321100 GGCTGGGGTGCATCAGGAGCCGG - Intronic
1161104879 19:2438380-2438402 GGCTGAGCTGCGGGCCCAGCTGG - Exonic
1161425287 19:4199673-4199695 GGCTGAGCCGCAGCTGCAGGGGG - Exonic
1162389085 19:10378345-10378367 GGCTGGGCTCCATCCCCAACGGG + Exonic
1164059655 19:21659872-21659894 GGCTGTGCTGCATACATAGCTGG - Intergenic
1164067021 19:21723485-21723507 GGCTGTGCTGCATACATAGCTGG + Exonic
1165124016 19:33581364-33581386 GGCAGAGGTGCATGGGCAGCTGG - Intergenic
1166669761 19:44702758-44702780 AGCTGGGCTGGATACGCAGCCGG + Intronic
1167036148 19:46996051-46996073 GGCTGAGGTGCATATGCAGAAGG + Intronic
1167054968 19:47104687-47104709 GGGTGGGCTGCATCCGAGGCAGG - Intronic
1168415217 19:56163420-56163442 GGCACAGGTGCATCCGCAGAAGG + Intergenic
925844857 2:8026122-8026144 GCCTCAGCTGCTTCCACAGCAGG + Intergenic
927295569 2:21449224-21449246 GCCAGAGCTGCATTTGCAGCAGG - Intergenic
930946718 2:57084569-57084591 GGCTGGGCTGCAACAGCACCCGG + Intergenic
932257779 2:70301987-70302009 GGCTGAGCTGCAGCAGCTCCGGG - Exonic
934519253 2:95009545-95009567 GGCTGTGCAGCCTCAGCAGCTGG + Intergenic
936284791 2:111173595-111173617 GCCTGAGCTGCAGCCCCAGCTGG + Intergenic
937466754 2:122139659-122139681 GGCTGGGCTGCCTCTGCTGCTGG + Intergenic
937886642 2:126903810-126903832 GGGTGAGCTACAGCAGCAGCAGG + Intergenic
942414495 2:175744866-175744888 GGCTGTGCTGCTTCCGGGGCCGG - Intergenic
946035792 2:216741157-216741179 GGCTTGGCTGCAGCCCCAGCTGG + Intergenic
947636888 2:231684757-231684779 GGCTGAGCTTCATGGGGAGCAGG + Intergenic
947938007 2:234024424-234024446 GCCTTAGCTGCCTCCGCACCAGG - Intergenic
948564328 2:238874064-238874086 GCCTGAGCTGCATCCCAGGCAGG + Intronic
948630735 2:239301043-239301065 GGCTGAGCAGCAGCAGCAGGAGG - Intronic
1169002600 20:2178809-2178831 GGCTGAGCAGCTCCTGCAGCTGG + Intergenic
1170386118 20:15818648-15818670 TGCTGGGCTGCATCCCCAGGAGG - Intronic
1172446976 20:34998357-34998379 GGAGGAGCTGCAGCGGCAGCTGG + Exonic
1172702885 20:36863561-36863583 GGCGGAGCCGCAGCCGGAGCCGG - Exonic
1173142253 20:40494596-40494618 CCCTGTGCTGCATCCTCAGCTGG + Intergenic
1173605284 20:44327043-44327065 GGCAGAGCTGCCTCCACACCCGG - Intergenic
1173955996 20:47033115-47033137 GGCTCACCTGCAGCAGCAGCTGG - Intronic
1176021357 20:62963905-62963927 GGGAGGGCTGCAGCCGCAGCAGG - Intronic
1177107503 21:16978452-16978474 GGCTGTGCTGCATATGCTGCAGG - Intergenic
1179918530 21:44494186-44494208 GACAAAGCTGCATCCTCAGCAGG - Intergenic
1181772962 22:25140121-25140143 GGCTGGGCTGCATTCTCAGCTGG + Intronic
1182198526 22:28544563-28544585 GGCTGGGCTGCATTCCCAGGAGG + Intronic
1184644003 22:45886354-45886376 GGCTGGGCTGCCTCCTCATCCGG + Intergenic
1184900730 22:47444952-47444974 GGCTGGGCAGCATCCACAGCAGG + Intergenic
950259647 3:11534902-11534924 GGCAGAGGCGCCTCCGCAGCAGG - Intronic
950487846 3:13283213-13283235 CGCGGAGCTGCGGCCGCAGCGGG + Intergenic
953749396 3:45597679-45597701 GGCAGAGCTGCTACCCCAGCAGG - Intronic
954875952 3:53803351-53803373 GGCAGAGGTGCAGCTGCAGCAGG + Intronic
955660356 3:61292451-61292473 GCCTGGGCTGCATCCACAGGCGG + Intergenic
956336470 3:68169828-68169850 GGCTGGGCAGCTTCAGCAGCTGG + Intronic
956777882 3:72580693-72580715 GGCTGATCTCCATGGGCAGCTGG - Intergenic
960224726 3:115156451-115156473 GGCTGGGCTGCATTTCCAGCAGG - Intergenic
967940373 3:194761696-194761718 CGCAGAGCAGCATCTGCAGCAGG + Intergenic
968503811 4:962948-962970 GGATGGGCTGCGCCCGCAGCTGG - Intronic
968910015 4:3472873-3472895 GGCTGAGCTTCAGCCCCAGGGGG - Intronic
969204505 4:5633264-5633286 GGCTGAGCTGCATTCTCCTCTGG - Intronic
969362683 4:6674553-6674575 GGCTCAGCAGCACTCGCAGCCGG - Intergenic
971235955 4:24842629-24842651 GGATGAGGTGCAGCTGCAGCTGG + Intronic
975415076 4:74096630-74096652 GGCTGGGCTGCATTCCCAGTAGG - Intergenic
975728950 4:77319291-77319313 GAATGAGCTGTATCAGCAGCTGG + Intronic
977604341 4:98967358-98967380 GGCTTAGCTGCTTCCACACCAGG - Intergenic
980782537 4:137510233-137510255 GGTTGAGCTGCATTCCCAGGAGG - Intergenic
982163831 4:152596717-152596739 GACTGAGCTGCATCAGCAAAGGG - Intergenic
985070012 4:186158524-186158546 GCCACAGCTGCATCAGCAGCAGG - Intronic
985497888 5:219822-219844 GTCTGAGGTGCCTCCGCCGCTGG - Intronic
987709828 5:21492662-21492684 GGCTGAGCCGAGTCTGCAGCAGG + Intergenic
988442777 5:31250800-31250822 GGCTGAGATGGCTCTGCAGCTGG - Intronic
988749785 5:34181501-34181523 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
989435566 5:41409318-41409340 GGCTGGGCTCCAGCCACAGCAGG + Intronic
991738044 5:69644705-69644727 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
991760150 5:69911719-69911741 GGCTGAGCCGAGTCTGCAGCAGG + Intergenic
991787182 5:70206381-70206403 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
991789620 5:70224431-70224453 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
991814369 5:70499541-70499563 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
991817504 5:70520833-70520855 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
991839381 5:70786770-70786792 GGCTGAGCCGAGTCTGCAGCAGG + Intergenic
991879628 5:71206771-71206793 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
991882068 5:71224800-71224822 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
992508427 5:77410059-77410081 GCCTGTCCTGCATCAGCAGCAGG - Intronic
993495353 5:88602719-88602741 GGCTGAGCTCCAGCCGAAGAAGG + Intergenic
994336950 5:98577815-98577837 GTCTGAACTGCATCCTGAGCGGG + Intergenic
994460580 5:100064771-100064793 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
994484730 5:100378182-100378204 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
999194861 5:149774980-149775002 GGGCGAGCTGCAGCCACAGCAGG + Intronic
999482264 5:151959565-151959587 GGCTCATCTGTATCAGCAGCCGG - Intergenic
999696269 5:154190770-154190792 GGCTGAGCTGCTGCCGCCGCCGG + Exonic
1001454313 5:171848875-171848897 GACTGAGCTGCAGCTCCAGCCGG + Intergenic
1002322307 5:178383155-178383177 GGCTGGGCTGCACCCAGAGCTGG - Intronic
1002836410 6:868786-868808 AGCTGGGCTGCATCTGGAGCTGG + Intergenic
1004016306 6:11735109-11735131 GGCTTATTTGCATCAGCAGCTGG - Intronic
1004615077 6:17281532-17281554 GCCCGAGCCGCAGCCGCAGCCGG + Exonic
1005547852 6:26887844-26887866 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
1006010557 6:31039638-31039660 AGTTGAGCTGCATCCTCATCTGG + Intergenic
1006327163 6:33363000-33363022 GGCTGAGCTGTGTCAGCACCAGG - Intergenic
1009018612 6:57928925-57928947 GGCTGAGCCGAGTCTGCAGCAGG - Intergenic
1013111714 6:107069837-107069859 GGATGATCTGCAGCCGCTGCGGG + Exonic
1013473687 6:110488115-110488137 TGCTGAGCTGCATTCCCAGCTGG + Intergenic
1018042155 6:159934315-159934337 GGCTGCTCTGCAACCTCAGCAGG - Intergenic
1018800869 6:167221518-167221540 GGTTGAGCTGCTTCCCCAGGCGG + Intergenic
1019696839 7:2450943-2450965 GGCTGAGCTGCCACCCCTGCGGG - Intergenic
1020217184 7:6202273-6202295 GGCTGAGGTGCTGCAGCAGCTGG - Intronic
1026521043 7:71118538-71118560 GTCAGAGCTGGATCAGCAGCCGG - Intergenic
1026800204 7:73395628-73395650 GGCTGGGCTGCATTCCCAGGCGG - Intergenic
1027831959 7:83188472-83188494 AGCTGGGCTGCATCCGGGGCTGG + Intergenic
1028567163 7:92246087-92246109 GGCTGAGCCGGAGCCGGAGCCGG + Exonic
1028593931 7:92528306-92528328 GGCCCAGCTGCATCTGCTGCAGG - Exonic
1032765425 7:134986962-134986984 ACCAGAGCTGTATCCGCAGCAGG + Intronic
1034174622 7:149090818-149090840 GACTGAGCGGCAGCCGCGGCCGG - Intergenic
1034180463 7:149133485-149133507 GGCTGGGCTGCATTCCCAGATGG - Intronic
1035397338 7:158543871-158543893 GGCTAAGCTGCCTCTGCACCAGG + Intronic
1037677904 8:21067694-21067716 GGCCTAGCTGTATCAGCAGCTGG + Intergenic
1037753073 8:21695293-21695315 GGAAGCGCTGCATCCCCAGCTGG - Intronic
1037825278 8:22156756-22156778 CGCGGAGCTGGAGCCGCAGCCGG + Exonic
1038006259 8:23433012-23433034 GGATGCGCCGCAGCCGCAGCAGG + Exonic
1038576799 8:28711591-28711613 GGCTGAGCTGCATCCTGAGCCGG + Intronic
1039089372 8:33812187-33812209 GGCTGAGCTGAACCAGGAGCTGG - Intergenic
1040829889 8:51664772-51664794 GGCTCAGCTTCATCCACAGTGGG - Intronic
1043369390 8:79573033-79573055 GGCTGGGCTGCATTCTCATCAGG + Intergenic
1047296237 8:123572781-123572803 GGCTGAACTACATCCCCAGAAGG - Intergenic
1049412704 8:142480457-142480479 GGAGGAGCAGCAGCCGCAGCTGG - Intronic
1049495105 8:142926376-142926398 GGCTGAGGTGCAGACTCAGCAGG - Intergenic
1049646404 8:143737808-143737830 GCCACAGCTGCATCTGCAGCTGG + Intergenic
1049681913 8:143922800-143922822 GGCCGAGCGGCAGCGGCAGCTGG - Exonic
1053131271 9:35617103-35617125 GGCCCAGCGCCATCCGCAGCCGG + Intronic
1053312329 9:37027566-37027588 GGCTGAGATGGAGCCGCAGTCGG + Intronic
1056507321 9:87269462-87269484 AGCTGGCCTGCATCCTCAGCAGG - Intergenic
1056801548 9:89695525-89695547 GGCAGAGCTGGCTCCACAGCCGG - Intergenic
1056967820 9:91179266-91179288 GCGTGAGCTGAACCCGCAGCTGG + Intergenic
1057138962 9:92715417-92715439 GGATGAGATGCAGCGGCAGCTGG - Exonic
1057209183 9:93190412-93190434 GGCTGAGCTGAATCAGGACCAGG + Intronic
1057305741 9:93911055-93911077 GGCTGAGGTGCATGGGGAGCTGG - Intergenic
1057545140 9:96014205-96014227 ACCTGAGCTGCCTCCGCTGCAGG + Intronic
1060394032 9:123303216-123303238 GGCTGAGCTGGAGTCACAGCTGG + Intergenic
1060596765 9:124853322-124853344 GGCGGAGGTGGAGCCGCAGCAGG - Intergenic
1060731314 9:126038803-126038825 GGCTGAGCTTGAGACGCAGCAGG + Intergenic
1061130818 9:128706772-128706794 TGCTGATCTTCATCCGCAGCAGG - Exonic
1061662669 9:132140568-132140590 GGCACAGCTGCATCCTCATCAGG - Intergenic
1062444548 9:136588138-136588160 GGCTGAGCGGCCCCTGCAGCTGG - Intergenic
1185566827 X:1101312-1101334 GGATGAGCTGCATCCACACCAGG - Intergenic
1185566858 X:1101512-1101534 GGATGAGCTGCATCCACACCAGG - Intergenic
1185566963 X:1102152-1102174 GGATGACCTGCATCCTCACCAGG - Intergenic
1185567007 X:1102432-1102454 GGATGACCTGCATCCTCACCAGG - Intergenic
1185567081 X:1102952-1102974 GGGTGAGCTACATACACAGCAGG - Intergenic
1185615576 X:1419701-1419723 GGCTCAGAAGCATCCTCAGCTGG - Intronic
1185786013 X:2891556-2891578 TGCTGAGCTGCATTCCCAGGAGG - Intergenic
1186830583 X:13386222-13386244 TGTTGAGCTGCATTCCCAGCAGG - Intergenic
1187784405 X:22867500-22867522 TGCTGCTCTGCATCCTCAGCTGG + Intergenic
1190289878 X:48985321-48985343 AGCTGAGTTGCAGCAGCAGCAGG - Exonic
1191807394 X:65149271-65149293 AGCTGGGCTGCATCCTCACCTGG + Intergenic
1192141094 X:68647692-68647714 GGCTCAGCTGCCTCGACAGCGGG - Intronic
1198219580 X:134587202-134587224 GGCTGAGCTCACTCCACAGCTGG + Intronic
1199606272 X:149582215-149582237 GTCTGAGCACCAGCCGCAGCCGG - Exonic
1199632850 X:149787153-149787175 GTCTGAGCACCAGCCGCAGCCGG + Exonic
1201063281 Y:10067473-10067495 TGCTGAGGTGCATCCTCACCGGG - Intergenic
1201739739 Y:17311122-17311144 GGAGGAGCTGCAGCAGCAGCAGG - Intergenic