ID: 1089618355

View in Genome Browser
Species Human (GRCh38)
Location 11:119707924-119707946
Sequence CAGTGGTAGTGGCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089618346_1089618355 26 Left 1089618346 11:119707875-119707897 CCTATACAATGTGTCAAGCATGG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG 0: 1
1: 0
2: 4
3: 31
4: 395
1089618351_1089618355 -5 Left 1089618351 11:119707906-119707928 CCTTTTGGGTGAAAGTGACAGTG 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG 0: 1
1: 0
2: 4
3: 31
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089618355 Original CRISPR CAGTGGTAGTGGCAAGAGGA AGG Intronic
900369932 1:2327773-2327795 CAGAGGCACAGGCAAGAGGAGGG - Intronic
900946852 1:5835674-5835696 CAGTGGTTGAGGCAGGAGGATGG - Intergenic
901791442 1:11655303-11655325 AGGTGGGAGTGGCAAGAGGGTGG - Intronic
905084954 1:35364957-35364979 CAGTAATAGAGGCAGGAGGACGG - Intronic
905174045 1:36125263-36125285 CCGTGGCTGTGGAAAGAGGAGGG - Intergenic
905315071 1:37077302-37077324 TTGTGGTAGAGGCATGAGGAGGG + Intergenic
905788735 1:40778824-40778846 CAGAGGTAGAGGTTAGAGGAAGG + Intergenic
905965017 1:42085290-42085312 CAGAGGTAGTTCCAAGAGAAAGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906698832 1:47842996-47843018 CAGAGGTAGTGTCATGATGAAGG + Intronic
907501223 1:54882855-54882877 CAGGGCTAGGGGCTAGAGGAAGG + Intronic
907748381 1:57237954-57237976 GAATGGTAGGGGCAAGAAGATGG + Intronic
909711600 1:78656263-78656285 CAGTGATCCAGGCAAGAGGAAGG + Intronic
910265978 1:85338062-85338084 AAGGAATAGTGGCAAGAGGAAGG - Intronic
910713774 1:90208533-90208555 CAGTGGTTGTTGCAAGAGCCTGG - Intergenic
911335055 1:96572798-96572820 CAGTACTAGAGCCAAGAGGAAGG - Intergenic
911377693 1:97071228-97071250 CAATGGTAGTGGAATAAGGAAGG + Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913075303 1:115336897-115336919 CAGTGGGTGTGCCCAGAGGATGG + Intronic
913132803 1:115857383-115857405 CCGAGGCAGTGGCAAGAAGAGGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
913630017 1:120700845-120700867 CCGTGGTGGAGGCAGGAGGAGGG - Intergenic
914560071 1:148808927-148808949 CCGTGGTGGAGGCAGGAGGAGGG + Intronic
914612762 1:149321288-149321310 CCGTGGTGGAGGCAGGAGGAGGG - Intergenic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915490461 1:156247523-156247545 CAGAGCTGGTGGCAAGAAGAGGG - Intronic
917586870 1:176436031-176436053 CAGAGATAGTGGTAACAGGAAGG - Intergenic
919043665 1:192424549-192424571 CAGTGGCAGTGGCCACAGGCAGG - Intergenic
919983762 1:202658796-202658818 CACTGGCAGGGGCAAGAGGAGGG - Intronic
920071361 1:203305426-203305448 CATTGGTCGCGGCCAGAGGATGG - Intergenic
920386866 1:205575713-205575735 AAGTGGGAGAGGGAAGAGGAAGG - Intronic
920948969 1:210555017-210555039 CCGTGATAGAGGCCAGAGGAAGG + Intronic
922412693 1:225391542-225391564 CAGTGGTAGTGGGCAGAAGCAGG + Intronic
923822473 1:237460318-237460340 CAGTCGTTCTGGCAAGAGTAGGG + Intronic
1063030284 10:2227757-2227779 CACTGGCAGTGGTAGGAGGAAGG + Intergenic
1063425151 10:5945006-5945028 CAGTGGTAGTGGAAATACTATGG - Intronic
1066036136 10:31487121-31487143 ACGTGGTATTGGCAAAAGGATGG - Intronic
1066354647 10:34670554-34670576 CAGTGGTAGTGGGATGGGGTTGG - Intronic
1067226168 10:44377548-44377570 AGGGGGTAGTGGCAAGATGATGG + Exonic
1068073391 10:52223909-52223931 CAGTGTTAATGCCAAGAGGTTGG - Intronic
1068510104 10:57954939-57954961 GAGTGGCAGTGGCTAAAGGAAGG + Intergenic
1070361254 10:75691716-75691738 CAGCTGTAATGACAAGAGGAAGG + Intronic
1070377175 10:75843985-75844007 CTGTGGTAGTGGCAGCAGAAAGG + Intronic
1070983073 10:80665834-80665856 CAGGGTTAGTGGGAAGGGGACGG + Intergenic
1071220505 10:83459615-83459637 CATTTTTAGTGGCAAGGGGAAGG - Intergenic
1071582930 10:86790103-86790125 CAGTGGCAGTGGCAAGATCTCGG - Intronic
1071960474 10:90804842-90804864 CATTGGAGGTTGCAAGAGGAAGG - Intronic
1071998952 10:91175525-91175547 CAGGGGTAGGGGGAAGAGGGAGG - Intronic
1072085867 10:92078557-92078579 CAGTTGTAGTGGAAAGAGTAGGG - Intronic
1072400003 10:95087849-95087871 CAGAGGTAGGGGCAAGAGATGGG + Intergenic
1072762216 10:98066012-98066034 CAGTGGTGGTGGGGAGAGTATGG + Intergenic
1073426657 10:103459216-103459238 CAGTGGGAAGGGCAAAAGGAGGG - Intergenic
1073728306 10:106260148-106260170 CAGTGTTTCAGGCAAGAGGAGGG + Intergenic
1074213462 10:111360576-111360598 GGGTGGTAGAGGCAGGAGGAAGG - Intergenic
1074302336 10:112243883-112243905 GATTGGTAGTTGCCAGAGGATGG + Intergenic
1075204615 10:120436292-120436314 CACAGATACTGGCAAGAGGAAGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1077262636 11:1630984-1631006 CAGGGGTGGAGGCAAGAAGATGG - Intergenic
1077838262 11:5944377-5944399 GAGTCGGAGTTGCAAGAGGAAGG + Intergenic
1077905566 11:6530252-6530274 GGGTAGAAGTGGCAAGAGGAGGG - Intronic
1079182271 11:18204320-18204342 CAGTGGCAGTGGCATGAGGCAGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079396166 11:20065706-20065728 CAGTGGCAGAGGCATGGGGAAGG + Intronic
1080934829 11:36851724-36851746 CTGTGGTGGTGGCAAGAGAGTGG - Intergenic
1084946438 11:72641397-72641419 CAGAGGTAGATACAAGAGGAAGG + Intronic
1086033202 11:82384610-82384632 CAGTGGTGGTGGCCACAGGGGGG + Intergenic
1086607552 11:88714276-88714298 CAGTGGTAGGTGAAAGGGGAGGG + Intronic
1086938278 11:92767789-92767811 CAGAGGTTTTGGCAGGAGGAAGG - Intronic
1087026167 11:93652094-93652116 CATTGCTACTGGCAAGAGCAGGG - Intergenic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1087503696 11:98993530-98993552 CAATGGTTGTGACAATAGGATGG + Intergenic
1087950707 11:104218147-104218169 CAGTGGTGGTGGCCACAGGGAGG - Intergenic
1088209619 11:107440233-107440255 AAGTAATAATGGCAAGAGGATGG + Intronic
1089006043 11:115091531-115091553 CAGTGGCAGTGGGAAGAGTAGGG + Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089268931 11:117287993-117288015 CAGTGTTAGTGGGAAGAGCTGGG - Exonic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089816699 11:121182732-121182754 CAGTGGTGGTGGCAACACGTTGG + Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1090985316 11:131761137-131761159 CCGTGAAAGTGGCAAGAGGCAGG + Intronic
1091058860 11:132443350-132443372 CAGTGGGAGTGGGCAGAGGGTGG + Intronic
1091552277 12:1545484-1545506 CAGAGGCTGAGGCAAGAGGATGG + Intronic
1094415482 12:30210866-30210888 CAGTGGCAGTGGCGTGAGCATGG - Intergenic
1095798241 12:46244491-46244513 GAGTGGTGGTGGCCAGAGCAAGG + Intronic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096872108 12:54599488-54599510 CAGTGGAAGTGGAAACAGGGTGG + Intergenic
1097013480 12:55969334-55969356 CAGTGGGAGGGGAAAGATGATGG + Intronic
1098074550 12:66715036-66715058 CAGTGGAAGTGGGCATAGGAAGG - Intronic
1098462805 12:70751414-70751436 AAGTGGTGGTGGACAGAGGATGG - Intronic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1099635491 12:85206310-85206332 AAGTGGTAGTGGCATAAGGCAGG + Intronic
1101391887 12:104308706-104308728 CAGTTGTAGTTGGAGGAGGATGG + Intronic
1101624540 12:106426110-106426132 CAGTGCTGCTGGCAGGAGGAGGG - Intronic
1104467305 12:129000791-129000813 CAGGGGTGGGGGCGAGAGGATGG + Intergenic
1104492057 12:129202743-129202765 CAGAGGGAATGGCATGAGGAAGG - Intronic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1105474800 13:20720649-20720671 CAGTCGGGGTGGCCAGAGGATGG - Intronic
1105832069 13:24171497-24171519 CAGTGGGAGTGCCACAAGGATGG + Intronic
1106166010 13:27246970-27246992 CAGTGGCTGAGGCAGGAGGATGG + Intergenic
1108284315 13:48891019-48891041 CACTCACAGTGGCAAGAGGAGGG + Intergenic
1108884698 13:55165496-55165518 CACTGGCAGTGGCAGGAGTATGG - Intergenic
1109011473 13:56952698-56952720 ATGTGGTATTGGCAAAAGGATGG + Intergenic
1109251651 13:60028351-60028373 TATTGGAACTGGCAAGAGGAAGG - Intronic
1109336585 13:61002901-61002923 CACTGGTAGTGGCCACAGGAGGG - Intergenic
1109663891 13:65504404-65504426 TGGTGGTAGCAGCAAGAGGAAGG - Intergenic
1109735198 13:66474730-66474752 CAGTGATAGTGGTAAGAGCCAGG - Intronic
1109868681 13:68302133-68302155 CCGAGGTAGTGGCAAGAAAAGGG - Intergenic
1109886460 13:68552063-68552085 CAGTGTGACTGGCCAGAGGATGG + Intergenic
1110151008 13:72253205-72253227 TTGGGGTAGTGGTAAGAGGAAGG - Intergenic
1110533764 13:76627472-76627494 CAGCAGGAGTGGCAAGAAGATGG + Intergenic
1112763237 13:102713793-102713815 CAGTAAAAGAGGCAAGAGGAGGG + Intergenic
1112955597 13:105054227-105054249 CAGTGGCAGTGGCATGATCATGG + Intergenic
1113115391 13:106869629-106869651 AAGAGGTATTGGCAAGAGGCAGG + Intergenic
1113519453 13:110929295-110929317 TAGAGGATGTGGCAAGAGGAAGG + Intergenic
1114378180 14:22172144-22172166 CACTGAGGGTGGCAAGAGGAAGG + Intergenic
1114452320 14:22835549-22835571 CAGAGGTAGTGCGAGGAGGAAGG - Intergenic
1114539448 14:23443749-23443771 GAGAGGTAGTGGGAAGGGGATGG + Intergenic
1115750254 14:36482442-36482464 CAGTGGTGGTGGCCAGCTGAGGG - Intronic
1116840021 14:49810514-49810536 CACTGGTACTGGCATGAGGATGG - Intronic
1116914906 14:50515258-50515280 GAGTGGTGGAGGCAAGAGAAAGG - Intronic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119535567 14:75400174-75400196 CAGTGATAGAGGCAAAAGAAGGG - Intergenic
1120798830 14:88666964-88666986 CAGTGGAGGTGATAAGAGGAAGG + Intronic
1122825196 14:104367370-104367392 CAGTGGAGGTGGCAAGGGCAGGG - Intergenic
1124180259 15:27466733-27466755 AAGTGGCAGAGGGAAGAGGAAGG + Intronic
1124647857 15:31452707-31452729 CAGTGGCACTGACAAGGGGACGG - Intergenic
1124689680 15:31811681-31811703 CAGTTGTGAGGGCAAGAGGAAGG - Intronic
1125539244 15:40460159-40460181 CAGTGGTACAGGCCACAGGAAGG + Intronic
1125542927 15:40481553-40481575 GAGTGGTAGTTGCCAGGGGATGG - Intergenic
1126378933 15:48026210-48026232 GAGTGGAAGTGGGAAGAGAAAGG - Intergenic
1126492242 15:49250207-49250229 CAGTGGTCATGGGAAGAGTAAGG + Intronic
1127033974 15:54894990-54895012 CAGTGGTAGTGGCCATAGGAGGG - Intergenic
1127960648 15:63887927-63887949 CAGGGGTAGGGTCAGGAGGAAGG - Intergenic
1129072660 15:72964012-72964034 CAGAGGTCGAGACAAGAGGAAGG - Intergenic
1129209494 15:74059377-74059399 CTGTGGTAATGGGAAGAGAATGG + Intergenic
1129559890 15:76554830-76554852 CAGTGGTAGTGGCATGATCTCGG + Intronic
1130095099 15:80849982-80850004 CAGTGGTGGTGGGGAGAGGGCGG + Intronic
1130231671 15:82101948-82101970 GAGTGGGAGTGGGAAGAGAAGGG + Intergenic
1130485900 15:84398431-84398453 CAGTGGTAGCTGCAAGGGCAGGG - Intergenic
1131219510 15:90570451-90570473 CAGTGGTGGAGTCAAGAGTAAGG - Intronic
1133303626 16:4797285-4797307 CACTGGAAGTGCCAGGAGGAAGG - Exonic
1133943880 16:10332616-10332638 GAGTGGCTGAGGCAAGAGGATGG - Intronic
1135250548 16:20898064-20898086 GGGAGGTAGTGGAAAGAGGATGG - Intronic
1135481890 16:22827488-22827510 CAGTGGTGGTGGAGAGAGAAAGG + Intronic
1136677035 16:31920053-31920075 CATTTGGAGTGGCAAGAGGAAGG - Intergenic
1137841632 16:51646234-51646256 CAGAGGCAGTGGCAAGAAAAGGG + Intergenic
1137994183 16:53191430-53191452 CAGTGGTGGTTGAAAGAGGTAGG - Intronic
1138453043 16:57105187-57105209 TAGTGGAAGTGGGGAGAGGACGG + Intronic
1139372927 16:66479772-66479794 CAGTGGCAGTGGGAAGAGAAAGG + Intronic
1139876279 16:70148605-70148627 CAGTGGTTGTGGGAAGGGAAGGG - Intronic
1140246206 16:73252343-73252365 CTGGGGTAGTGGCATGGGGACGG + Intergenic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141033079 16:80606554-80606576 CAGAGGAAGTGGCAAGAGTGAGG - Intronic
1142489638 17:269985-270007 CATGGGTGGTGGCAGGAGGAGGG - Intronic
1142788312 17:2243038-2243060 CAGTGGCAGTGGCAGGACGGGGG + Intronic
1142951206 17:3481964-3481986 CAGAGGCAGTGGTGAGAGGAAGG + Intronic
1143252285 17:5532682-5532704 CTGTTGTCTTGGCAAGAGGAGGG + Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144810798 17:17997684-17997706 CAGTGGGAGTGGCAAGAGCAGGG - Intronic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146649538 17:34598248-34598270 CAGTGGAAGTGGCCTTAGGAAGG - Intronic
1146694517 17:34898418-34898440 CAGCGGTAGAGGGAAGAGGAGGG - Intergenic
1147565609 17:41534832-41534854 CAGGGGTGGGGGCACGAGGATGG - Intergenic
1148752466 17:49953141-49953163 CAGGGGGAGTGGGAAGAGGGAGG + Intergenic
1150290654 17:63979636-63979658 CAGGGGTGGAGGCAAGTGGAAGG - Intergenic
1150731279 17:67697405-67697427 CAGTGGCAGTGGTATGGGGATGG - Intergenic
1151476356 17:74346233-74346255 CAGTGGCCTTGGCAGGAGGACGG + Intronic
1151592053 17:75051644-75051666 TGGTGGGAGAGGCAAGAGGATGG - Intronic
1152574742 17:81135070-81135092 CAGTGGGTTTGGCAAGGGGACGG - Intronic
1153577280 18:6535373-6535395 CAGTGGTAGCTGCAATATGAAGG - Intronic
1153855835 18:9145632-9145654 CAGTGCCAGTGGCAAGAGGGTGG + Intronic
1154079532 18:11242702-11242724 CAGTGTTAGTGGCACTGGGATGG + Intergenic
1154079964 18:11246618-11246640 AAGAGGTCGTGGCAAGAGCAGGG - Intergenic
1155385819 18:25276046-25276068 CAGTGATAGTGGAAAAAGCAGGG + Intronic
1156388607 18:36629286-36629308 CACTGGTACTGGCATGAGCATGG + Intronic
1156445188 18:37231484-37231506 CAGAGGGAGTGCCAAGAGGGAGG + Intronic
1157402404 18:47399592-47399614 AAGTGGGAGTGGCCAGTGGAAGG + Intergenic
1157927103 18:51778643-51778665 CAGTGATAGAGGGATGAGGAGGG + Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158591424 18:58782117-58782139 GAGGGATGGTGGCAAGAGGAGGG - Intergenic
1159468564 18:68818528-68818550 GAGTGGTAATGACAGGAGGAAGG - Intronic
1160353442 18:78205513-78205535 CAGTGGTAATGGGTAGAGGCTGG - Intergenic
1161576019 19:5054856-5054878 GAGTGGTAGTGACAAGAGCGAGG - Intronic
1162476471 19:10903224-10903246 TAGTGGTACTGGCAAAAGAAAGG - Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1165149823 19:33753872-33753894 GAGGGGTAGTGGTAGGAGGATGG - Intronic
1166585942 19:43949139-43949161 CAGTGGCAGTGGCAACATGGTGG + Intergenic
1167397276 19:49238895-49238917 CAGGGGTGGGGGCAAGGGGAGGG - Intergenic
1167684840 19:50949830-50949852 GAGTGGGAGTTCCAAGAGGAGGG - Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
926346969 2:11955814-11955836 CAGTGTTTGAGGCAAGAGCAGGG + Intergenic
926370700 2:12176034-12176056 CAGTGGTCTTGGCATGAGAAGGG + Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927420279 2:22923883-22923905 CACTGGAAGGGCCAAGAGGAGGG - Intergenic
927973762 2:27322607-27322629 CATTGGAAGTGGGAAGGGGAAGG - Intronic
928105565 2:28468631-28468653 CAGTGGGCCTGGCCAGAGGAGGG + Intronic
930151974 2:48068611-48068633 CAGTGGTAATGGCGAGTGGTGGG + Intergenic
930525655 2:52525982-52526004 CAATGGTAGTTGCCAGAGGTAGG - Intergenic
930565985 2:53021323-53021345 TAGTGGTAGTAGTAATAGGATGG + Intergenic
930674346 2:54184257-54184279 GAGTGGTATTAGCAAGAGAATGG + Intronic
931067594 2:58604200-58604222 GAGTGGGAGAGGCAATAGGAAGG + Intergenic
931438140 2:62266749-62266771 CAGTGGTAGGACCAAGAGAAGGG + Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
932190134 2:69734244-69734266 CAATGGTAGTCTCAGGAGGATGG - Intronic
932275870 2:70451883-70451905 CAGTGGTCTTAGGAAGAGGATGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934688439 2:96338595-96338617 CAGTGGTCCTTGTAAGAGGAAGG + Intronic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935812941 2:106817645-106817667 CAGTGGTGGTGGCTACAGGGAGG + Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936168035 2:110140897-110140919 CAGTAGTAGTGGTAAGAACAAGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936616406 2:114052191-114052213 CAGTGGTAATTGAAATAGGAGGG - Intergenic
937979317 2:127605187-127605209 CTGGGCTAGTGGCCAGAGGAGGG + Intronic
938429367 2:131218729-131218751 CAGGGGGAGCGGCAAGAGCAAGG + Exonic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
938990451 2:136622969-136622991 GAGGGGTACTGGCAAGAGCAGGG + Intergenic
940002648 2:148982048-148982070 CATTGCTACTGGCAAGAGCAGGG + Intronic
940839473 2:158562463-158562485 CAGTGGTGGTTGCCAGAGGCTGG + Intronic
941067507 2:160919926-160919948 CAGTGGTGATGGCAGCAGGATGG + Intergenic
941287132 2:163628663-163628685 CAGAGGTAGAGTCAAAAGGATGG + Intronic
942638938 2:178039994-178040016 AGGTGGTGGTGACAAGAGGAAGG + Intronic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
944285266 2:197942357-197942379 CAGTGGTAGTGGCAATACGGAGG - Intronic
945504929 2:210628211-210628233 CAGTTGTAGTGTCAAGTGGATGG + Intronic
946028299 2:216685747-216685769 CAGTGGTTGTGGCAGGGGGAAGG + Intronic
946552516 2:220818518-220818540 CAGTGGTATTGGCACATGGATGG - Intergenic
946818992 2:223610864-223610886 CAGTGGCAGTGGCATGATCATGG - Intergenic
947532275 2:230917708-230917730 CAGAGGTTAAGGCAAGAGGATGG + Intronic
948883827 2:240873326-240873348 CAGAAGCAGTGGGAAGAGGAAGG + Intronic
1168923603 20:1561095-1561117 CTCTGGTAGTGGACAGAGGAAGG + Intronic
1169313742 20:4570858-4570880 CAGTGGAAGTGGCAGGATGCTGG - Intergenic
1170355079 20:15483417-15483439 GTGTGGTATTGGCAAAAGGATGG - Intronic
1170788920 20:19491734-19491756 GAGTGGGAGAGGAAAGAGGAAGG + Intronic
1171482926 20:25467610-25467632 CATTAGTAGTGGCAACAGCAGGG - Intronic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1172074292 20:32282210-32282232 CAGTGGAGATGGTAAGAGGACGG + Intronic
1172272106 20:33660483-33660505 CGGTGGCAGTGCCAAGAGCAGGG + Intronic
1172280361 20:33703606-33703628 CACTGGTAGGGGCATGAGGAAGG + Exonic
1173455674 20:43199427-43199449 CAGGGATATTGGCAAGGGGAAGG + Intergenic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1174409456 20:50324612-50324634 CAGGGCTAGTGGGAAGAGAACGG + Intergenic
1174625136 20:51907886-51907908 CAGAGGTTGTGGTAGGAGGATGG + Intergenic
1174663334 20:52234811-52234833 CACTGGTAGTGGTATGTGGAAGG - Intergenic
1175114616 20:56673405-56673427 CAATGGAAGTGACATGAGGAGGG - Intergenic
1175473219 20:59249006-59249028 CAGGGGCAGGGGCAAGATGATGG - Intronic
1175618710 20:60424875-60424897 TGGTGGCAGTGGCAAGGGGAGGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1177939592 21:27392220-27392242 CAGTGGTACTGGCTACAGGGGGG - Intergenic
1178530008 21:33368311-33368333 GACTGATAGTGGCAAGAGGCAGG + Intergenic
1178753893 21:35329281-35329303 CATTGGAAATGGCAAGAAGATGG - Intronic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1181001092 22:19988062-19988084 CAGTGGGTCTGGCAAGAGAAAGG + Intronic
1181264347 22:21622027-21622049 AAGTGGGAGTGGCAAGGGTAGGG - Exonic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
1182228073 22:28815482-28815504 CAGAGGTATATGCAAGAGGAGGG + Intergenic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
949361001 3:3232041-3232063 CATTGAGAGTGGCAAGAGAAAGG - Intergenic
949840211 3:8312074-8312096 CAGCGGTAGAGGGAAGAGTAAGG + Intergenic
949973591 3:9433742-9433764 TAGTGGTTGTGGAAAGAGGAGGG + Intronic
950492598 3:13315003-13315025 CAATGGCAGGGGCATGAGGAGGG + Intergenic
951632429 3:24736468-24736490 CAGTAGTAGTTGGAAGAAGAGGG + Intergenic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
952810373 3:37397220-37397242 CAGTGGATGTGGCAAGATGGAGG - Intronic
952945191 3:38474250-38474272 CCATGGTAGTGGCAAGTGGGTGG + Intronic
953248865 3:41224617-41224639 CTGTGGTAGTGGCACCAGAATGG - Exonic
953885439 3:46712273-46712295 CAGTGGGAGTGCCAGGAGCAGGG + Exonic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955079027 3:55640617-55640639 CTGTGGTAAGGGCATGAGGAAGG + Intronic
955721533 3:61886556-61886578 CAGTGGAGGTGGCAAGGGGCAGG - Intronic
955978030 3:64496939-64496961 CAGTGGTGGAGGCCAGAAGATGG - Intergenic
956122206 3:65977704-65977726 ATTTGGTAGTGGCAGGAGGATGG - Intronic
958755010 3:98241345-98241367 CAGTGATAGTCCCAAGAGAATGG + Intergenic
958975852 3:100667320-100667342 CAGTGGTGGGGGCTAGGGGAGGG - Intronic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
959206114 3:103309075-103309097 CAGTCCTAGTGGCGAGAGGGAGG - Intergenic
959357655 3:105353453-105353475 CAGTGATAATGGCAAGAGACCGG + Intergenic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961623167 3:128240435-128240457 AAGAGGAAGTGGCAAGAGCAGGG - Intronic
962187032 3:133270981-133271003 CAGTGGTTGTGTCAAGAGGATGG - Intronic
962671041 3:137708931-137708953 CAGGGGTGTTGGAAAGAGGATGG + Intergenic
962868353 3:139466508-139466530 CAGAGGAACTGGCAAGAGGCTGG + Intronic
963117174 3:141739971-141739993 CAGTGGCAGTGGCAGGAACAAGG - Intronic
968067021 3:195764350-195764372 CGGTGTTGGTGGCAAGAGCATGG + Intronic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
969105107 4:4801605-4801627 CAGTGGTAATGGGAGGAGGCTGG - Intergenic
969979151 4:11136615-11136637 CAGGGTTAGTGACCAGAGGAAGG - Intergenic
971052517 4:22877362-22877384 CAGTGGGACTGGCAAGAGTAGGG - Intergenic
971974190 4:33662299-33662321 CAGAAGTAGTGGGAAGGGGAAGG - Intergenic
972034006 4:34497492-34497514 CAGGGGTAGTGGCAAGGGACTGG - Intergenic
974224419 4:59019980-59020002 CAGTGGTTTTGGGAAAAGGAAGG - Intergenic
974551324 4:63379326-63379348 AATTGATAGTGGCAAGAGGCAGG + Intergenic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
977240073 4:94557448-94557470 CAGTGGTAGTTGGATGGGGATGG + Intronic
977275836 4:94976460-94976482 AAGTGGTTGTGGTTAGAGGATGG - Intronic
977618817 4:99113684-99113706 TGGTGGTAGTGGGAAGAGTAGGG + Intergenic
978005169 4:103606367-103606389 CAGTGGTAGTTGGATGGGGATGG + Intronic
981643351 4:146969990-146970012 AAGTGGAAGAGGCATGAGGAGGG + Intergenic
981665817 4:147224852-147224874 GGGTGGTAGGGGCAAGGGGAGGG + Intergenic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982216579 4:153087571-153087593 CAATCGTAGTGGCAATAGTATGG + Intergenic
983680743 4:170350785-170350807 TATTGGTAGAGGCAAGCGGAAGG - Intergenic
984133290 4:175905110-175905132 CTGTGGAAGTGACAAGATGAAGG + Intronic
986548438 5:8924996-8925018 CAGTGGTGGTGGTGACAGGAGGG + Intergenic
987962052 5:24823558-24823580 CAGTGGGAGGGGGAAGAGAAAGG - Intergenic
989109395 5:37892611-37892633 TAATGGTAGGGGAAAGAGGAAGG - Intergenic
991659670 5:68937554-68937576 CAGTGGTGGTTGCTAGAGGCTGG + Intergenic
991952508 5:71960273-71960295 CAGTGGTGGCTGCATGAGGATGG - Intergenic
992149535 5:73889316-73889338 CAGTTAAAGTAGCAAGAGGATGG + Intronic
992311561 5:75506115-75506137 CACTGGGAGTGGGAAGGGGAAGG + Exonic
993963574 5:94332368-94332390 CGGGGGTGGTGGCAAGGGGAGGG - Intronic
994185242 5:96808430-96808452 CACTGGCAGTGGCGAGATGACGG - Intergenic
994658919 5:102629887-102629909 CTCTGGTAATGGCAAGAGAATGG - Intergenic
996472250 5:123874565-123874587 CACTGGAAATGGCAAGTGGATGG + Intergenic
999212203 5:149899618-149899640 GAGAGGAGGTGGCAAGAGGATGG + Intronic
999243341 5:150140072-150140094 GAGTGGTAGGGACAAGAGGCTGG + Intronic
999784908 5:154882255-154882277 CAGTGGAAGGGGGAAGATGAGGG - Intergenic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1003358556 6:5399598-5399620 CAGAGGTGGTGGAAACAGGATGG - Intronic
1003397176 6:5763399-5763421 CAGTGGCAGTGGCACAATGATGG - Intronic
1003623437 6:7722894-7722916 CAGTGATAGTGGGAATAGGACGG - Intergenic
1003791721 6:9553619-9553641 CAGTGATAGTGGCAGGAGGTAGG - Intergenic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1004184844 6:13413052-13413074 CAGTGGCAGAGCCAAGAGGGTGG - Intronic
1004995782 6:21191595-21191617 CAGTGGCAGTGGCAGAAGAAAGG - Intronic
1005438892 6:25843877-25843899 AAGTGGGAGTGGCCAGAGTAAGG - Intronic
1005680952 6:28207705-28207727 CAGAGGTTGTGGCCAGGGGAAGG + Intergenic
1005843993 6:29763269-29763291 CAGGGGCAGTGGGAAGATGAGGG - Intergenic
1005941507 6:30563597-30563619 GAGTTGTATTGGCAAGAGGGAGG + Exonic
1005959966 6:30687411-30687433 CAGTGGTTGGGGCGAGAAGAGGG - Exonic
1007449138 6:41930105-41930127 GAGGGGAAGTGCCAAGAGGAGGG - Intronic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1008801896 6:55378616-55378638 CCATGGTAGTGGCAAGACGTGGG - Intronic
1011561608 6:88623129-88623151 AAGTGGGAGTGCCAAGGGGAGGG + Intronic
1012253656 6:97008134-97008156 CAGTGGTGGTGGCATGGGGTTGG + Intronic
1013373532 6:109491454-109491476 AAGTGGTAGGGGTAAGAGCAAGG + Intergenic
1014159726 6:118154112-118154134 CAATGGTAGTGGGAAGGGGGTGG - Intronic
1014197890 6:118579907-118579929 CACTTGTAGTGACAAGAAGAAGG - Intronic
1014811191 6:125887835-125887857 TAGTAGTAGTGGTAAGTGGATGG + Intronic
1015826359 6:137316804-137316826 CAGTGGTTCTGGCAGGAGGTAGG - Intergenic
1015927466 6:138324280-138324302 GAATGGTAGTGGCAAGAGTTGGG - Intronic
1016346266 6:143117229-143117251 AAGTGGCAGTGGCAGGAGGCAGG + Intronic
1017045505 6:150343925-150343947 CACTGAGGGTGGCAAGAGGAAGG + Intergenic
1018689732 6:166334990-166335012 CAGAGGTAGTGCCAAGAAAAGGG + Intronic
1019536404 7:1531606-1531628 CAGTGGGAGCGGGAAGAGGCCGG - Intronic
1019635501 7:2073447-2073469 TAAGGGTAGGGGCAAGAGGAGGG - Intronic
1021249923 7:18311944-18311966 CCGTGGTAGTGCCAAGAGGGTGG - Intronic
1021438503 7:20650081-20650103 CAATGGCAGTGGGAAGAGTACGG + Exonic
1023173088 7:37408733-37408755 CAGTGGTAGTTGCCAGGGGCTGG + Intronic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1028153959 7:87408084-87408106 CAGTGGCTGTGGGAAGAGCACGG - Exonic
1028186347 7:87790117-87790139 CAGTGATGGTGGCCATAGGAGGG + Intronic
1031589380 7:123570786-123570808 CAGTGGTAATGGGAAATGGATGG - Intronic
1034685863 7:152970812-152970834 CACTGAGGGTGGCAAGAGGAAGG + Intergenic
1035928592 8:3756898-3756920 CAGAGGTTGAGGCAAGCGGATGG - Intronic
1037019179 8:13947129-13947151 CAGAGGATTTGGCAAGAGGATGG + Intergenic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1039946814 8:42136888-42136910 CAGAGACAGTGACAAGAGGAGGG + Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040590313 8:48786796-48786818 GAGTGGGTGTGGCATGAGGAAGG + Intergenic
1041486017 8:58377040-58377062 CAGTGGGAGTGGCATGATCATGG - Intergenic
1041902708 8:62999452-62999474 CAGTGTTTGTGTCATGAGGATGG - Exonic
1042322940 8:67497270-67497292 CATTAGTAGTTGCAAGGGGATGG - Intronic
1042631826 8:70825844-70825866 CAGGGGTAGAGGAAAAAGGAAGG - Intergenic
1043382879 8:79722102-79722124 CAGAGGCTGAGGCAAGAGGATGG + Intergenic
1044457289 8:92403211-92403233 GAGTGGTAATGTCAATAGGATGG + Intergenic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1045724889 8:105160765-105160787 CAGTGGCGGGGGCAAGGGGAAGG - Intronic
1047101409 8:121680312-121680334 CAATGGCAGTGGGAAAAGGAAGG - Intergenic
1047933987 8:129757938-129757960 TAGTGGTAGTGGCATGAACATGG - Intronic
1047984566 8:130219441-130219463 CAGAGGTATAGGGAAGAGGAGGG + Intronic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048711192 8:137212851-137212873 CAGAGATATTGGCAACAGGAAGG + Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049279382 8:141736648-141736670 GGGTGGCAGTGGCATGAGGAGGG - Intergenic
1049618587 8:143587782-143587804 CAGTGGGAGTGGCACGAGGTGGG - Intronic
1049747467 8:144269083-144269105 CCGTGGTGGTGGGAGGAGGATGG - Intronic
1049986170 9:953950-953972 AAGTGATAGTGGCACAAGGAAGG + Intronic
1051415266 9:16833158-16833180 AATTGGTGGTGGCAAGAGAAGGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053315627 9:37048910-37048932 CCTTGGTTGTGGCAAGAGCATGG - Intergenic
1053320549 9:37094672-37094694 CCTTGGTTGTGGCAAGAGCATGG - Intergenic
1053523905 9:38809686-38809708 CAGAAGCAGTGACAAGAGGATGG - Intergenic
1053593070 9:39533468-39533490 CAGTGGTCGTGGAAATGGGAGGG - Intergenic
1053850807 9:42288176-42288198 CAGTGGTCGTGGAAATGGGAGGG - Intergenic
1054196138 9:62034098-62034120 CAGAAGCAGTGACAAGAGGATGG - Intergenic
1054573236 9:66831809-66831831 CAGTGGTCGTGGAAATGGGAGGG + Intergenic
1054642267 9:67554591-67554613 CAGAAGCAGTGACAAGAGGATGG + Intergenic
1057901559 9:98953066-98953088 CAGTGGTAGTGGGTAGGTGAGGG + Intronic
1058638644 9:107061170-107061192 CATTGGTAATGGAAAGAGCATGG - Intergenic
1061849503 9:133406158-133406180 CAGTGGCACTGACAAGGGGACGG - Exonic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062123619 9:134847862-134847884 CAGAGGGAGTGGGGAGAGGAAGG + Intergenic
1062204854 9:135330357-135330379 CCCTGGGACTGGCAAGAGGAGGG + Intergenic
1062251586 9:135598827-135598849 CATTAGGGGTGGCAAGAGGAAGG - Intergenic
1187614473 X:20978085-20978107 CACTTGTAGTAGCAAAAGGAAGG - Intergenic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1190259164 X:48787154-48787176 CAGAGATGGTGGTAAGAGGATGG - Intronic
1190418626 X:50205548-50205570 CAGTGGCTGCGGCAGGAGGATGG + Intronic
1190437306 X:50438213-50438235 GGGTGGAAGGGGCAAGAGGAGGG - Intronic
1190495268 X:51022493-51022515 CATTGAAAGTGGCAAGGGGAAGG + Intergenic
1190714645 X:53093333-53093355 GAGTGGTAGCGGGAAGAGGCAGG + Intergenic
1192104039 X:68295983-68296005 CAGCAGTATTGGCAATAGGAGGG + Intronic
1192465704 X:71354175-71354197 CAGTGGCAGTGGCATGAACATGG + Intergenic
1193407678 X:81122201-81122223 CTGTGGTGCTGGCAAGAGGAGGG + Intronic
1194066936 X:89272148-89272170 AAATGGAAGTGGCAAGAGTACGG + Intergenic
1194986856 X:100499856-100499878 GAGTGGAAGTGGGGAGAGGAGGG + Intergenic
1195158940 X:102152683-102152705 CAGTGGTAGAAGCCAGTGGAGGG + Intergenic
1195609353 X:106847593-106847615 GAGTGGTAGTGGGAATGGGAAGG + Intronic
1196357180 X:114808903-114808925 CAGTGGTGGTGGCCACAGGTTGG - Intronic
1196889756 X:120280586-120280608 CAGTGATGGAGGCATGAGGATGG - Intronic
1198157778 X:133979125-133979147 AAGTGGAAGTGGCAATAAGAAGG - Intronic
1199403131 X:147424066-147424088 GAGTGGTATAAGCAAGAGGATGG + Intergenic
1199533411 X:148874768-148874790 CAGTGGCAGTGCTAAGATGATGG + Intronic
1199791854 X:151162194-151162216 GAGTGGTAGTGGGAAGAGAAAGG + Intergenic
1200082758 X:153587128-153587150 GCGTGGTAGTGAAAAGAGGAAGG - Intergenic
1200721099 Y:6606310-6606332 AAATGGAAGTGGCAAGAGTACGG + Intergenic